ID: 1070247321

View in Genome Browser
Species Human (GRCh38)
Location 10:74744551-74744573
Sequence AAGAATGAGGAGAAGTGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070247321 Original CRISPR AAGAATGAGGAGAAGTGGTG CGG (reversed) Intergenic
902759767 1:18573500-18573522 TGGAATGAGGAGACGTGGTGGGG - Intergenic
902769431 1:18637062-18637084 AAGAATGGGGAGAGGGTGTGTGG - Intronic
903268965 1:22176073-22176095 AACAAGGAGGGGAGGTGGTGAGG - Intergenic
903423072 1:23232596-23232618 AAGAATGCAGAGAAGAGATGAGG + Intergenic
904317402 1:29674562-29674584 AAGAATGGGGAGAGATGGGGTGG + Intergenic
904842384 1:33381097-33381119 AAGCAAGAGGAGAAGAGTTGGGG - Intronic
904979327 1:34483767-34483789 AAGAATCAGGACAAGTGGACAGG - Intergenic
905551518 1:38844468-38844490 AAGAAACAGGAGAGGTGGTCGGG + Intronic
905867985 1:41386654-41386676 AAGAAATAGGAGAGGAGGTGTGG - Intergenic
905868013 1:41386797-41386819 AAGGATGAGGTGGAGGGGTGGGG - Intergenic
906749168 1:48243167-48243189 AATAATAAAGAAAAGTGGTGGGG - Intronic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907621301 1:55983485-55983507 AAGAAAGAGGAGGAGAGGGGAGG + Intergenic
908456645 1:64310641-64310663 AAAAAGGAAAAGAAGTGGTGGGG - Intergenic
911148218 1:94571751-94571773 AGGAAAGTGGAGAAGGGGTGGGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911304653 1:96218211-96218233 AAAGATGGGTAGAAGTGGTGGGG - Intergenic
911449080 1:98042458-98042480 AAGACAGAGGAGAAGTGCTAAGG - Intergenic
912848532 1:113100737-113100759 AAGCATAAGGAGCAGTGCTGAGG - Intronic
913318031 1:117568646-117568668 AAGAATGATTAGAAGTGGCCAGG + Intergenic
914213858 1:145607063-145607085 AAGAATGGGTAGAACTGATGTGG - Intergenic
914465803 1:147927468-147927490 AAGAATGGGTAGAACTGATGTGG - Intergenic
915457611 1:156051164-156051186 AAGCCGGAGGAGCAGTGGTGGGG - Exonic
915506096 1:156357322-156357344 CAGTATGAGGGGAAGGGGTGAGG + Intronic
915507014 1:156364216-156364238 GAGAATGAGGTGGAGTGGAGAGG + Intronic
915675467 1:157526125-157526147 AAGACTGAGAAGAAGTGGCCAGG + Intronic
915901824 1:159852635-159852657 AAGTATCAGGAAAAGTAGTGTGG - Intronic
916206236 1:162318822-162318844 TGGAAGGAGGAGGAGTGGTGTGG - Intronic
916385360 1:164261311-164261333 AAGAATAATGAGAAGATGTGAGG - Intergenic
917161564 1:172062516-172062538 AAATAGCAGGAGAAGTGGTGAGG - Intronic
917305118 1:173616873-173616895 AAGAATGAAGAAAAGTAGAGTGG + Intronic
917448491 1:175126839-175126861 AAGAAGGAGGAGAAATGGGAGGG + Intronic
917493847 1:175522108-175522130 AAAAAAAAGGAGAAGTGGAGTGG - Intronic
917717670 1:177754407-177754429 AAGAAGGCAGAGCAGTGGTGGGG + Intergenic
918103782 1:181399060-181399082 AGGATTGAGGGGATGTGGTGGGG - Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919566927 1:199200382-199200404 TAGAATGGGGAGAATTGGAGTGG - Intergenic
919748386 1:201022444-201022466 AAAAACTGGGAGAAGTGGTGAGG + Intronic
920737317 1:208544668-208544690 AGGAATAAGGAGGAGTGGGGTGG + Intergenic
920823923 1:209406625-209406647 AAGAATTAGAGAAAGTGGTGAGG - Intergenic
920866790 1:209759947-209759969 AAGAGGGAGGAGAAGGGGAGGGG - Intronic
920979686 1:210821627-210821649 AGGAATGTGGAGAAGTGGGGTGG + Intronic
921471783 1:215558125-215558147 AATGTTGAGTAGAAGTGGTGAGG + Intergenic
921691844 1:218160647-218160669 CAGAAGGAAGAGAAGTGGAGAGG - Intergenic
921985131 1:221304638-221304660 AAGACTGGGGAGCAGGGGTGGGG - Intergenic
922180112 1:223226833-223226855 AACATTGAGAAGAAGAGGTGAGG - Intronic
922390804 1:225138799-225138821 GAGAGTGAGGAGAAGCAGTGGGG - Intronic
922621492 1:226991986-226992008 AAGAGTGAGGAGGAGAGGAGGGG + Exonic
922936294 1:229425713-229425735 AAGAAAGAGGAGGAGGGGGGAGG + Intergenic
922975416 1:229779728-229779750 AAGGAGAAGGTGAAGTGGTGGGG + Intergenic
923072353 1:230577592-230577614 AAGAAGGAGGAGGAGGGGTAGGG - Intergenic
924517808 1:244780822-244780844 AAGAAGGTAGAGAAGTGGAGTGG - Intergenic
1062801208 10:381861-381883 AAGAGAGAGGAGGTGTGGTGTGG - Intronic
1062910274 10:1207876-1207898 AAGAATGAGGAAAACTGCAGAGG - Intronic
1063358542 10:5427416-5427438 GAGAAGGAGAAGAAGTGGGGAGG - Intronic
1063426796 10:5956670-5956692 AAGGATGAGGAGCAGAGGTGTGG - Intronic
1063440222 10:6067002-6067024 AAAAAAGGGGAGAGGTGGTGAGG + Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065560946 10:26963164-26963186 CAGAATGAGGCAAAGTGGGGAGG - Intergenic
1066395786 10:35020258-35020280 AAGAATGCTGAGAAGTGGGGAGG + Intronic
1067174807 10:43938093-43938115 GAGAAGGAGGAGGAGTGTTGAGG + Intergenic
1067360171 10:45572126-45572148 AGGAAAGTGGAGAAGGGGTGGGG - Intronic
1067360190 10:45572184-45572206 AGGAAAGTGGAGAAGGGGTGGGG - Intronic
1067508880 10:46878504-46878526 AAGAATGAGGAGGGGAAGTGAGG + Intergenic
1067818850 10:49508550-49508572 AAGGATGACTAAAAGTGGTGGGG + Intronic
1068181586 10:53526479-53526501 AATAATGAATAGAAGTGCTGAGG - Intergenic
1068690552 10:59909525-59909547 AAGAAGGAGGAGAAATGATAGGG - Intergenic
1068705580 10:60071727-60071749 AAGAATCAGGAGATTTGGTGGGG + Exonic
1068977748 10:63029751-63029773 AAGAATGAGGCCGAGTGCTGTGG + Intergenic
1069362016 10:67653770-67653792 AAGCATGAGGATAGGGGGTGGGG - Intronic
1069449053 10:68501525-68501547 GAGAAAGAGGAGAAGAGGAGAGG + Intronic
1069903240 10:71717842-71717864 AAGAAAGAAGAGAGGTGGGGTGG + Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1070457342 10:76630470-76630492 AAGAATGATGAAAAGTGGCCAGG - Intergenic
1070850392 10:79558346-79558368 AGGAAAGAGGACAAGGGGTGGGG - Intronic
1070856826 10:79612950-79612972 AGGAAAGAGGACAAGGGGTGGGG + Intronic
1071150225 10:82625683-82625705 AAGATTGAGGAGAAATGTTTGGG - Intronic
1071447070 10:85758476-85758498 AACAATGAGGAGAAGCTATGTGG - Intronic
1071472358 10:85992600-85992622 GAGGATGAGGAGAGGTGGGGGGG + Intronic
1071561952 10:86651950-86651972 GAGGAGGAGGAGAAGTGCTGAGG + Intergenic
1071702539 10:87955590-87955612 AAGAAAGAGAAGGAGTGGTGGGG + Intronic
1071742395 10:88374956-88374978 AAGAATGAGAGCAAGTGGGGAGG - Intronic
1072481648 10:95814859-95814881 AAGAAGGAAGGGAAGGGGTGGGG - Intronic
1074021898 10:109593365-109593387 GAGAATGAAGAAAAGTGGCGAGG + Intergenic
1074126787 10:110534956-110534978 AAGAAGGAGGAGGAGGGGAGGGG + Intergenic
1074192557 10:111150402-111150424 AGGAAGGAGGAGAAGAGGGGAGG + Intergenic
1074575278 10:114663095-114663117 AAGGATGAAGAGATGTGTTGAGG - Intronic
1074615785 10:115066716-115066738 AAGAAAGATAAGATGTGGTGAGG - Intergenic
1074894739 10:117765438-117765460 AAGGAGGAGAAGAAGAGGTGAGG - Intergenic
1075508086 10:123043748-123043770 AAGAATGAGGAAAACAGTTGGGG - Intronic
1076091834 10:127693299-127693321 AAGAATGAGTAGGAGTGGGCGGG + Intergenic
1076242304 10:128917547-128917569 TAGAGGGAGGAGAAGGGGTGAGG + Intergenic
1076556479 10:131324824-131324846 AAGAATGAGGAGGAGAGCAGAGG - Intergenic
1077618222 11:3694648-3694670 AAGAATGAGGTGAACTTGGGAGG + Intronic
1077923274 11:6656486-6656508 GGGAATGAGGAGAAGGCGTGAGG - Intergenic
1078366401 11:10710179-10710201 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1078480921 11:11674655-11674677 GTGAATGAGAAGAAGTGCTGGGG - Intergenic
1078659664 11:13277272-13277294 AAGAAGAAGGAGGAGGGGTGAGG + Intronic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1080047201 11:27821443-27821465 AGGAAAGAGGAGACGTGCTGAGG + Intergenic
1080105541 11:28507871-28507893 TAGAATGAGGAGAACTGGAATGG - Intergenic
1080573466 11:33577779-33577801 GAAAAAGAGAAGAAGTGGTGTGG - Intronic
1080727274 11:34910974-34910996 AAGGATGAGGTGAAATGATGAGG + Intronic
1080851924 11:36077785-36077807 AAGAAGGAAGAGAAGAGCTGTGG - Intronic
1081159457 11:39735097-39735119 AGGAAAGTGGAGAAGGGGTGGGG - Intergenic
1081623096 11:44630730-44630752 AAGGAAGAGGAGAGGTGGAGGGG + Intergenic
1081786227 11:45749804-45749826 AAGTGTGAAGAGAAGGGGTGAGG - Intergenic
1081832135 11:46122240-46122262 AGGAGCGAGGAGAAGTGATGGGG + Intergenic
1082869428 11:57930504-57930526 AAGAGAGAGGAGGTGTGGTGTGG + Intergenic
1084304002 11:68270043-68270065 AATAATGAGAATAACTGGTGGGG - Intronic
1084746198 11:71171583-71171605 AACAATGAAGAGAAGGGGCGAGG - Intronic
1085326573 11:75610989-75611011 AAGAAAGTGGAGAAGTGAGGAGG - Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1085500955 11:77023313-77023335 TATAATAAGGAGAAGAGGTGTGG + Exonic
1085667566 11:78428499-78428521 AAACATTAGGAGAAGTGGTGGGG + Intergenic
1085906100 11:80764955-80764977 AGAAATCAGGAGAAGAGGTGAGG - Intergenic
1086808569 11:91274800-91274822 AAGAATGAGGAAAAATAGGGAGG - Intergenic
1087948098 11:104189372-104189394 GAGATGGAGGAGACGTGGTGAGG + Intergenic
1088440840 11:109868248-109868270 AGGAATGAGGAGTAGGAGTGGGG - Intergenic
1089256462 11:117196843-117196865 AAGAAGGAAGGGAAGGGGTGAGG - Exonic
1089394842 11:118129868-118129890 ATGAATGAGGAAACGTGGGGAGG + Intergenic
1089631167 11:119785316-119785338 AAGAATTCAGAGAAATGGTGAGG + Intergenic
1090493128 11:127183456-127183478 GAGAAGGAGGAGAGGAGGTGAGG + Intergenic
1090752580 11:129760361-129760383 AAGAAAGAGGAGAAAGGATGGGG - Intergenic
1090758815 11:129817299-129817321 AAGAATCAGGACACGTGGTTAGG + Intronic
1091792272 12:3278757-3278779 AACCATGAGGAGGAGGGGTGTGG - Intronic
1092380147 12:7989209-7989231 AAGAATTAAGGGAAGAGGTGTGG - Intergenic
1093893488 12:24551196-24551218 ATGAATGAGGAGTATTGGTTTGG - Intergenic
1094231845 12:28114826-28114848 AGGCATGAGGAGCAGTGATGTGG + Intergenic
1094779505 12:33774277-33774299 AAGAATGAAGAGAAGTTTAGAGG + Intergenic
1095341918 12:41100176-41100198 AAGAAAGAGGAGAACTGGTTTGG + Intergenic
1095651899 12:44620925-44620947 GAGAATGGGGAGGATTGGTGGGG - Intronic
1096176133 12:49520455-49520477 CAGAATGAGGAGATATGATGGGG - Intronic
1096546446 12:52343427-52343449 GAGAATGAGGCAAAGTGGTCTGG + Intergenic
1097144409 12:56930042-56930064 AGGGATGAGGAGAAGAGGTAGGG - Intronic
1097734828 12:63170567-63170589 AAGAATGAGGAGCAGTTGACAGG - Intergenic
1099171085 12:79365030-79365052 ATGTATGAAAAGAAGTGGTGGGG - Intronic
1099510196 12:83525511-83525533 AAGGGTGAGGAGGAGAGGTGGGG + Intergenic
1100211446 12:92402571-92402593 AAGAAGGAGGGGGAGAGGTGAGG - Intergenic
1100549194 12:95631012-95631034 AAGACAGAGGAGAGGTGATGGGG + Intergenic
1100705835 12:97199172-97199194 AAGAAAGAGCAAAAGTGGTTGGG + Intergenic
1101550349 12:105755528-105755550 AAAAATAGGGAGAATTGGTGTGG + Intergenic
1101748001 12:107558825-107558847 AAGAGTGAGGAGATGTTCTGGGG + Intronic
1102209624 12:111116328-111116350 CAGAATATTGAGAAGTGGTGAGG + Intronic
1102483576 12:113241043-113241065 AAGAATGAGCAGGAGTGGCCAGG - Intronic
1103197590 12:119058681-119058703 AAGCATCAGAAGAAGTGGGGAGG - Intronic
1103274022 12:119696815-119696837 AAAAAGGAGGGGAGGTGGTGCGG - Intronic
1103539526 12:121656167-121656189 AGGAGTGAGGAGAAGAGTTGCGG - Intronic
1105585350 13:21738117-21738139 AAATAGGAGGAGAAGGGGTGAGG + Intergenic
1105596320 13:21842686-21842708 AAGGAAGAGGATAAGTGGTTGGG + Intergenic
1105654638 13:22423027-22423049 AAAAATTAGGAAAAGTGGGGAGG - Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1105863918 13:24442102-24442124 AAGCGTGAGGGGAAGTGGGGAGG + Intronic
1105864650 13:24448465-24448487 AAGAATGATGAGTGTTGGTGAGG + Intronic
1106338138 13:28803371-28803393 AAGGATGAGGAGAAGCTGGGCGG + Intergenic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1106917842 13:34534386-34534408 TAGTGTGAGGAGATGTGGTGGGG - Intergenic
1107100106 13:36581128-36581150 CAGAATGAGGAGATGTGGTTTGG - Intergenic
1107107439 13:36660285-36660307 AGGAAAGAGGAGAAATGGGGAGG + Intergenic
1107234089 13:38147517-38147539 AAAAATGTAGAGAAATGGTGAGG - Intergenic
1107725083 13:43291217-43291239 AAGGATGTGCAGAAGTAGTGAGG - Intronic
1108247567 13:48533003-48533025 AAGAGGGTGGAGGAGTGGTGTGG - Intronic
1108454552 13:50599717-50599739 AAGACAGAGGAGAAGTGGGAGGG - Intronic
1109267343 13:60216739-60216761 AACAAGGAGGAGAATTAGTGTGG + Intergenic
1109294644 13:60514576-60514598 AAGACTGAGGGGAAGTGTTGGGG + Intronic
1109796251 13:67317117-67317139 AACAATGAGGACATATGGTGGGG - Intergenic
1110330520 13:74267062-74267084 AAGTATGAGGAGAATGGGCGGGG - Intergenic
1110738465 13:78966118-78966140 AAGATTGAGAAGCAGTGTTGGGG - Intergenic
1110903031 13:80847985-80848007 AATATTGAAAAGAAGTGGTGAGG + Intergenic
1111231350 13:85347878-85347900 TAGAATGAGGGAAATTGGTGAGG - Intergenic
1111405024 13:87793012-87793034 AAGAATGTGCAGCAGGGGTGTGG + Intergenic
1112141819 13:96652396-96652418 AAGAAGGAACAGAAGTAGTGAGG - Intronic
1112539439 13:100293561-100293583 AAGAATGAGGAGAAATTATTGGG + Intronic
1113263371 13:108591138-108591160 AAGAGTCAGGAGATGAGGTGAGG - Intergenic
1113823336 13:113231317-113231339 AAGAATGAGCAAAGGTGGTCAGG + Intronic
1113898839 13:113784551-113784573 AAGAAGGAGGAGAAGGGAGGAGG + Intronic
1113997074 14:16097441-16097463 CAGAATGTGGAGATGTGGAGTGG - Intergenic
1114875795 14:26716276-26716298 AAAAATGGAAAGAAGTGGTGTGG - Intergenic
1115052883 14:29086126-29086148 AAGAATGTGGGGAAGGGGAGTGG - Intergenic
1115154642 14:30323922-30323944 AAGAAGGAGGAGAAGAAGAGGGG + Intergenic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1116664086 14:47752593-47752615 AATATTAAGGAAAAGTGGTGAGG - Intergenic
1117165305 14:53027099-53027121 AAGAATTGAGAGAAGTTGTGGGG + Intergenic
1117267239 14:54102669-54102691 AAGGATGTGGATTAGTGGTGAGG - Intergenic
1117361307 14:54977168-54977190 AAAATTGGGGAGAAGTGCTGGGG + Intronic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1117796444 14:59399020-59399042 GAGGAAGAGGGGAAGTGGTGGGG - Intergenic
1118071531 14:62251299-62251321 AAGGAGGAGCAGAAGTGGTGTGG - Intergenic
1118341795 14:64900092-64900114 ATGAATGTGGAGAAGTTGAGAGG - Intergenic
1118365159 14:65088486-65088508 AGTAATGAGGAGAAGTGGATAGG + Intronic
1118718961 14:68580260-68580282 AAGCAGGAGGCGAAGAGGTGGGG - Intronic
1119277497 14:73371934-73371956 AAGAAAGAGGAGAAGTGACCAGG + Intronic
1121495312 14:94388130-94388152 AAGCAGTAGGAGAGGTGGTGAGG + Intronic
1121952361 14:98182802-98182824 AGGAAAGAGGAGGAGTGGGGTGG - Intergenic
1124995043 15:34715484-34715506 GAGAAGGAAGAGAAGTGCTGAGG - Intergenic
1125130923 15:36283426-36283448 AGTAATGCGGAGATGTGGTGGGG - Intergenic
1125440123 15:39692854-39692876 AAGAAAGGGGAGAAGGGGAGTGG + Intronic
1126644073 15:50857537-50857559 AAGAATGAGTACAAGTGTGGAGG + Intergenic
1126778486 15:52119221-52119243 ATGAATGAGGAGAGGGGGAGGGG + Exonic
1126805651 15:52345947-52345969 AAGAGTGAAAAGAAGTGATGAGG - Intronic
1127338904 15:58020447-58020469 AAGAACGAGGAGAATATGTGAGG + Intronic
1127988133 15:64090993-64091015 AACAATAAAGAGAAATGGTGAGG + Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129846620 15:78770718-78770740 GAGACTGAGGAGCAGTGGGGAGG + Intronic
1129974720 15:79812688-79812710 AAGGATGAGTAGGGGTGGTGAGG + Intergenic
1130127427 15:81105409-81105431 AAGAAAGAAGAGAAGGAGTGAGG - Intronic
1130255292 15:82323235-82323257 GAGACTGAGGAGCAGTGGGGAGG - Intergenic
1130599682 15:85266771-85266793 GAGACTGAGGAGCAGTGGGGAGG + Intergenic
1131229088 15:90647231-90647253 AGGATTGAGGAGGAGGGGTGTGG - Intergenic
1131229096 15:90647257-90647279 AGGATTGAGGAGGAGGGGTGTGG - Intergenic
1131229122 15:90647341-90647363 AGGATTGAGGAGGAGGGGTGTGG - Intergenic
1132667951 16:1090524-1090546 AGGAGTGAGGCGAAGTGGAGAGG + Exonic
1134624573 16:15714532-15714554 AGGAAGGAGGTGAAGTGGCGGGG + Intronic
1134743176 16:16566498-16566520 GAGGAGGAGGAGAAGTGGGGGGG - Intergenic
1134924384 16:18145962-18145984 GAGGAGGAGGAGAAGTGGGGGGG + Intergenic
1135495801 16:22950092-22950114 AAGAGTGGTAAGAAGTGGTGGGG + Intergenic
1135898438 16:26431966-26431988 AAGAATGATAAAAACTGGTGTGG + Intergenic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1137426029 16:48381725-48381747 AAGAAAGAAGATAAGTGGTTGGG + Intronic
1137811145 16:51353883-51353905 AACAAGGAGAAGAAGTAGTGTGG + Intergenic
1138065430 16:53936368-53936390 ATGGAGGTGGAGAAGTGGTGGGG - Intronic
1138160218 16:54746417-54746439 AAAAAAGAGGAGAAGGGGAGGGG - Intergenic
1139218923 16:65158805-65158827 AACAATAAGGATAAATGGTGAGG + Intergenic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1140765394 16:78152238-78152260 AAGAATGAGGAGAAATGATACGG - Intronic
1141685312 16:85566676-85566698 AAGAATGACAAGAGGTGGGGAGG - Intergenic
1142666768 17:1467807-1467829 ATGGATGGGGAGGAGTGGTGGGG - Intronic
1143456154 17:7069437-7069459 AATAATGGGGTGTAGTGGTGTGG - Intergenic
1143791792 17:9302560-9302582 AAGAGTGAGCAGAAGCGGTGTGG + Intronic
1144307549 17:13982999-13983021 AGGAATGAGGAGGAGGGGTTAGG + Intergenic
1144431671 17:15198334-15198356 GAGAATGAGGAAAAGCGGAGTGG + Intergenic
1146012499 17:29207113-29207135 AAGAGTGAAGAGAAGGGGTTTGG - Intergenic
1146498291 17:33342787-33342809 ATGAATGAGGAGGTGTGGAGGGG - Intronic
1148186503 17:45648491-45648513 AAGAAAGAGAAGAAGTGTGGAGG - Intergenic
1148569437 17:48656335-48656357 AAGATTAAGGAGGAGTTGTGGGG + Intergenic
1149124667 17:53213764-53213786 AAGGAAGAGAAGAAGCGGTGGGG - Intergenic
1149357893 17:55862570-55862592 AAGGATGAGGGAAAGTGGAGAGG - Intergenic
1149818772 17:59753301-59753323 CACAATTAGGAGAAGTGATGGGG + Intronic
1149914683 17:60598335-60598357 AGGAAGGAAGAGAAGTGGTTTGG + Intergenic
1150481800 17:65516751-65516773 AAGAATGAGGAAGAGAGATGCGG + Intergenic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1152164956 17:78697636-78697658 AAGAATGAGTAAGAGTGCTGTGG + Intronic
1203213801 17_KI270730v1_random:104545-104567 TGGAATGAGGTGAAGTGGAGTGG + Intergenic
1153110301 18:1578666-1578688 AAGAAAGAGAAGAATGGGTGGGG - Intergenic
1153395035 18:4609845-4609867 AAGAATGGGGAGATCTGGAGTGG + Intergenic
1153552745 18:6279309-6279331 AAGAGTGAGGAGAAGAGGAGGGG + Intronic
1154031231 18:10756006-10756028 GAGAATGAGGAGGAGGGATGGGG + Intronic
1154031353 18:10756625-10756647 GAGGATGAGGAGGAGGGGTGGGG + Intronic
1155421622 18:25662765-25662787 AACAATTAGGAGCAGTGGTGTGG - Intergenic
1156329419 18:36105627-36105649 AAGAATGAGCAGCAGAGGGGAGG - Intergenic
1156421284 18:36955890-36955912 AAGGGTGAGGTGAAGTGGTGGGG + Intronic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1157357522 18:46949215-46949237 GAGAAGGAGGAGAAGTAGTTAGG - Intronic
1157426978 18:47592477-47592499 GAGGATGAGGAGGAGTGGGGAGG - Intergenic
1157488643 18:48107286-48107308 AAGATTGAGGAGGAGTGAGGAGG + Intronic
1157633359 18:49123568-49123590 TGGAAGGAGGAGAAGTGGTTGGG - Intronic
1158385888 18:56991126-56991148 AAAAATGAGGAGAAGGTGTACGG - Intronic
1158972056 18:62677681-62677703 AAGAATGGAGAGATTTGGTGTGG + Intergenic
1158993012 18:62889541-62889563 AGGAAGGAAGAGAAGAGGTGGGG - Intronic
1159658904 18:71068722-71068744 GAGACAGAGGTGAAGTGGTGTGG + Intergenic
1160316249 18:77850411-77850433 AGGAATGAGAAGAAGGGATGAGG - Intergenic
1160448579 18:78946831-78946853 AGGAAGGAGGAGAAGGGGAGAGG + Intergenic
1162176813 19:8836465-8836487 AAGAAGGAGGAGGAGAGGGGGGG - Intronic
1162467466 19:10850823-10850845 AAGAATGTGGAGCAGAGATGGGG - Intronic
1163247924 19:16108860-16108882 AAGAATGAGCTGAAGTGGAAGGG + Intergenic
1163689233 19:18729845-18729867 AAGAACGAGGATAAGGAGTGTGG - Intronic
1164234960 19:23323740-23323762 AAGAATGAGAAAAAGAGGAGAGG - Intronic
1164235024 19:23324142-23324164 AAGAATGAGGAAAAGAGAAGAGG - Intronic
1164292342 19:23879775-23879797 AAAAAGGAGGAGAGGAGGTGGGG + Intergenic
1164431920 19:28196459-28196481 AAGAATGAGGAGGAGTGGGGAGG - Intergenic
1164510678 19:28894511-28894533 ATGAAACAGGAGAAGTGGGGTGG + Intergenic
1164816720 19:31209851-31209873 CAGAATGGGGAGAAGGGGTTGGG - Intergenic
1167483674 19:49747689-49747711 AAGAAAGAGGAGAAATGGAATGG - Intronic
1168064539 19:53911580-53911602 AAGAATGTGGAGAAGGGACGAGG + Intronic
925697907 2:6601887-6601909 AGAGATGAGGAGAAATGGTGAGG - Intergenic
926016242 2:9454420-9454442 AAGAAATAGCAGCAGTGGTGAGG + Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926823754 2:16881917-16881939 AAGAGATTGGAGAAGTGGTGTGG + Intergenic
927567485 2:24125514-24125536 AAGAAAGAAAAGCAGTGGTGGGG - Intronic
927648386 2:24895380-24895402 AAGAATGAAGAGAATTGGTCAGG - Intronic
928048073 2:27958374-27958396 AATATTGAGGAGAAAGGGTGAGG + Intronic
928459949 2:31462673-31462695 AAAAATGAGAAGAAGTAGTGTGG + Intergenic
928665578 2:33547841-33547863 AGGAAGGAGGAGAAGCGGGGTGG + Intronic
931515424 2:63048259-63048281 AAGAAAGAGGAGAGGGGGAGAGG - Intergenic
931603621 2:64029768-64029790 AAGAATGAGGATGTGTGCTGGGG - Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
931975188 2:67636413-67636435 AAGAATGAAGAGAAGTAAAGAGG - Intergenic
932224008 2:70024727-70024749 AAATGTGGGGAGAAGTGGTGTGG - Intergenic
932314353 2:70769550-70769572 GAGAATGGGGAGAAGTCTTGTGG - Intergenic
932625955 2:73295991-73296013 AAGAAGGAGGAGGAATGCTGTGG - Intergenic
932989661 2:76771436-76771458 AAGAATGAGGAATGGAGGTGAGG + Intronic
933058806 2:77709298-77709320 AAGAAAGAAGAGAAATGGAGCGG + Intergenic
933158700 2:79001386-79001408 AGGAATGAAGAGAAGAGGGGAGG - Intergenic
933422261 2:82064173-82064195 AAGAATGAAGAAAAGAGTTGTGG + Intergenic
933854864 2:86403429-86403451 AAGGATGAGTAGCAGTGTTGGGG + Intergenic
934511174 2:94946027-94946049 AAGAAGGTGGGGAAATGGTGGGG - Intergenic
935560461 2:104553738-104553760 ACAAATGAAGAGAAATGGTGAGG + Intergenic
935902831 2:107810953-107810975 GAGAAATAGGAGAAGTGGGGAGG + Intergenic
935913672 2:107925442-107925464 AAAAATGAGAAAAAGTTGTGGGG - Intergenic
935942252 2:108252851-108252873 AAAAAGGAGGAGAAGTAGGGGGG + Intronic
936323341 2:111484934-111484956 AAAAAAAAGAAGAAGTGGTGAGG + Intergenic
936738609 2:115476287-115476309 CAGAATGAGGGAAAGTGGAGAGG - Intronic
937142043 2:119610369-119610391 AACAAAGAGGAGAAATGGTGGGG + Intronic
938710099 2:133968759-133968781 AAGAAGAAGGAGAAGTTTTGAGG - Intergenic
938995269 2:136671812-136671834 CAGAATGAAGAGAAGTCATGGGG + Intergenic
939522183 2:143245187-143245209 ATGAGTGAGGAGAAATGATGAGG + Intronic
940285953 2:152033181-152033203 ATGAATGAGGAGAAGCGGGGTGG + Intronic
940524781 2:154799464-154799486 AGGAAGGAGGAGGGGTGGTGGGG + Intronic
940740208 2:157498730-157498752 AAGAATGAGGAGGAGTAAAGAGG - Intergenic
940851659 2:158692956-158692978 AACCATGGTGAGAAGTGGTGGGG - Intergenic
941399142 2:165008939-165008961 AAGAGAGAGAAGAAATGGTGAGG + Intergenic
941622119 2:167789918-167789940 AAGAATAAGGACAAGAGGAGTGG - Intergenic
941638800 2:167965100-167965122 AACAAAGAGGAGAGGTAGTGGGG + Intronic
942060833 2:172227308-172227330 AAGGATGAGGAGCACTGGTGTGG - Intergenic
942576145 2:177365221-177365243 AGGAATGAGGAGATGTGGTCTGG + Intronic
943061405 2:183045031-183045053 AGGAAAGTGGAGAAGGGGTGGGG - Intergenic
943543003 2:189241140-189241162 AATAATGAGGATATGTGGTGGGG - Intergenic
945575073 2:211520504-211520526 AAGAAAGAAGAGAAGGGGAGAGG + Intronic
945703613 2:213201642-213201664 AAGAAGGAGGAGGAGGGGGGAGG - Intergenic
945935396 2:215898432-215898454 ATGACTGAGGAGCAGAGGTGAGG - Intergenic
946361354 2:219220936-219220958 AAGAATGAGGAACAGGGCTGGGG + Intronic
947515512 2:230800689-230800711 AGGATTGAGCAGCAGTGGTGTGG + Intronic
947662585 2:231880780-231880802 AAGAAAGGGGAGTAGTTGTGGGG - Intergenic
948036206 2:234860098-234860120 GAGAAGGAGGAGATGTGGGGTGG + Intergenic
948167122 2:235871511-235871533 AAGCATGAGTGGAAGTTGTGAGG - Intronic
949035882 2:241815596-241815618 AAGAATAAGAGGAAGGGGTGGGG - Intronic
1168865734 20:1084899-1084921 GAAAATGAGGAGGTGTGGTGTGG - Intergenic
1169595843 20:7197280-7197302 AAGATTGAGTAGAAGTGATGGGG + Intergenic
1169625067 20:7557017-7557039 AAGAATGAGGAGATGTTGGATGG - Intergenic
1169735814 20:8836388-8836410 GAGAATGAGGAGAGCTGATGGGG + Intronic
1169928026 20:10803295-10803317 AAGAATGTGGATCAGTGGTATGG - Intergenic
1169948515 20:11015398-11015420 AAGAATAAAGAGGTGTGGTGCGG - Intergenic
1170683456 20:18547499-18547521 GAGGATGAGAAGAAGGGGTGGGG - Intronic
1170685139 20:18562895-18562917 AAGAACGAGAGGAAGAGGTGGGG - Intergenic
1171987288 20:31669357-31669379 AAAAATGTGGTGAGGTGGTGAGG - Intronic
1172874014 20:38153227-38153249 AAGAATGAGCAGATGTGGCCGGG + Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173344727 20:42188287-42188309 AAGAATGAGAAGAAATGGCTGGG + Intronic
1173660483 20:44729842-44729864 AAGGATGACGTGCAGTGGTGTGG - Intergenic
1173812335 20:45963717-45963739 AAGTATGTGGAGCAGAGGTGAGG - Exonic
1174224280 20:48984362-48984384 AGATATGAGCAGAAGTGGTGTGG - Intronic
1174442057 20:50563683-50563705 ATGAATGGGGATAAGTGGTCTGG - Intronic
1174710804 20:52703061-52703083 AAGGGTGAGGAGAGGTGGGGTGG - Intergenic
1174758226 20:53181030-53181052 AAGAAAGGTGAGAAATGGTGGGG - Intronic
1176028568 20:62999054-62999076 AAGGAGGAGGAGGAGTGGGGAGG + Intergenic
1176529411 21:7946530-7946552 AACAATGTGGTGAAGTGGAGAGG - Intergenic
1176753940 21:10711771-10711793 TAGAATGTGGTGAAGTGGAGTGG - Intergenic
1176755196 21:10720709-10720731 TGGAATGTGGAGAAGTGGAGTGG - Intergenic
1176756802 21:10731602-10731624 TAGAATGTGGTGAAGTGGAGTGG - Intergenic
1176872693 21:14096556-14096578 AAGAGTGAGGAGAAACGCTGGGG - Intergenic
1176928001 21:14773917-14773939 TAGGATGAGGATAAGTGTTGAGG - Intergenic
1179220913 21:39406388-39406410 AAGCATGCAGAGAAATGGTGTGG - Exonic
1181527174 22:23496613-23496635 AAGACTGAGAAGATGCGGTGTGG + Intergenic
1182414129 22:30210181-30210203 AAGACTGAGGATAAGTGGGAGGG + Intergenic
1182825042 22:33257719-33257741 AAGAATGAGCAGCTGTGGAGAGG + Intronic
1182880672 22:33730636-33730658 ATGAATGATGAGAAGTGGAGAGG + Intronic
1184259836 22:43308319-43308341 AAGAATGGGAAAAGGTGGTGGGG + Intronic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
950587301 3:13903850-13903872 GAGAATGAAAAGAAGTGGGGTGG + Intergenic
950727238 3:14924341-14924363 AAGAAAGAGGAGGAGGGGAGAGG - Intronic
950774625 3:15338792-15338814 AAGAGTGTGGAGAAGATGTGAGG + Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951428391 3:22576801-22576823 AGGCCTGAGGAGAAATGGTGGGG + Intergenic
951849915 3:27127846-27127868 AAGAGTGTGGAGAAGCGGAGAGG - Intronic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
951991388 3:28679336-28679358 AGGAATGGGGAGAAGAGGGGTGG - Intergenic
952059238 3:29487529-29487551 GAGAATGATGAGAAGTGGAAGGG - Intronic
952828656 3:37545075-37545097 AAGGATGAGGGGAAGGGGAGTGG + Intronic
953843107 3:46405855-46405877 AAGAAGGAGGAGGAGGGGCGGGG - Intergenic
954440297 3:50518100-50518122 CAGAATGAGGAGGTGGGGTGTGG + Intergenic
955120517 3:56053361-56053383 AGGGATGGGGAGAAGTGGGGAGG + Intronic
955500950 3:59582314-59582336 CAGATGGAGGAGAAGGGGTGAGG - Intergenic
955581130 3:60423893-60423915 AAGAATGAAGAGAAAAGGTGGGG - Intronic
956542402 3:70355771-70355793 AAGGAGTAGGAGAAGTGGAGAGG + Intergenic
956705566 3:71996160-71996182 AAGGAGGAAGAGAAGGGGTGGGG - Intergenic
957439406 3:80224456-80224478 AAGAACCAGGAGAAGTGAAGAGG - Intergenic
957735056 3:84192456-84192478 AAGAAAGTGGAGAAGGGGTGGGG + Intergenic
957923315 3:86775450-86775472 ACAAATGAGGAGAGGTGGAGAGG - Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
959937930 3:112049139-112049161 AAGGCTGAGGTGAATTGGTGCGG - Intronic
960213696 3:115003345-115003367 AATAATGGGGAAAAGTGGGGAGG + Intronic
960313110 3:116141337-116141359 AAGAGTGAGAAGAAATGGAGGGG + Intronic
960374974 3:116889557-116889579 AAGAATGAAGAGAAGTGGGTCGG + Intronic
960379994 3:116948172-116948194 AAAAATGAGGAGAAATGCTGTGG - Intronic
961804007 3:129475831-129475853 AAAAATGAAGAGAAGTAGTATGG + Intronic
962055821 3:131870624-131870646 AAGAAGGAGGGGAAGAGGAGGGG - Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
963732548 3:148987243-148987265 AAGCCGGAGGAGCAGTGGTGGGG - Intergenic
964781821 3:160347439-160347461 AAAAATGAGCAGAAGAGGTATGG - Intronic
965984579 3:174736190-174736212 AAGAAAGAAGAGAAGAGCTGTGG - Intronic
966247446 3:177824923-177824945 CAGAGTGAGGAGAGGAGGTGGGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967443067 3:189531314-189531336 ATCAATGATGAGAAGGGGTGGGG + Intergenic
967881122 3:194302432-194302454 AAGATAGAGGAGAATCGGTGGGG + Intergenic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968742184 4:2336877-2336899 AAGAGTGAGGAGGTGAGGTGAGG + Intronic
968761253 4:2443653-2443675 AAGAGTGCGGAGTAGGGGTGAGG + Intronic
970400543 4:15713102-15713124 AAGCAAGAGGAGAGGTAGTGTGG + Intronic
971034445 4:22677784-22677806 AAGAGTAGGGAGAAGAGGTGGGG - Intergenic
971201585 4:24514093-24514115 AGGATTGAGCAGAAGTGATGGGG - Intergenic
971579427 4:28315684-28315706 AATAATGATAAGAAGAGGTGAGG - Intergenic
972038791 4:34562535-34562557 AAAAATGAGAAAAAGTGGTTAGG - Intergenic
972701211 4:41495837-41495859 AAGAAAGAAGAGCAGTGGGGAGG - Intronic
973039329 4:45451135-45451157 ATGAGGGAGGAGGAGTGGTGTGG - Intergenic
973240236 4:47948900-47948922 TAGAATGAGTAGAAGCGGAGAGG + Intronic
973947646 4:55975964-55975986 AAGAATAAGGCCAGGTGGTGTGG + Intronic
974153550 4:58042142-58042164 AAGAATGATGGCAAGGGGTGTGG - Intergenic
975393077 4:73842825-73842847 AAGAAAGGGGAGGAGAGGTGAGG + Intronic
975406178 4:73993220-73993242 AAGAAAGGGGAGAAGAGGTGAGG - Intergenic
976439469 4:85056586-85056608 ATGACAGAGGAGAAGTGGTTAGG - Intergenic
976747775 4:88421739-88421761 AAGAATGTGGAAAAGTGGTCGGG - Intronic
977308127 4:95351079-95351101 AAGAGTTATGAGAAATGGTGGGG - Intronic
978182935 4:105823171-105823193 CAGAATGAGGAAAAGCTGTGGGG + Intronic
978465360 4:109003010-109003032 ATGAGTGAGGACATGTGGTGAGG + Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979640898 4:123012050-123012072 AGGAAAGTGGAGAAGGGGTGTGG + Intronic
979641007 4:123012405-123012427 AGGAAAGTGGAGAAGGGGTGGGG + Intronic
980340270 4:131535337-131535359 AACTATGTGCAGAAGTGGTGTGG + Intergenic
981378564 4:144044189-144044211 ATGAATGAGAACATGTGGTGTGG - Intergenic
981759452 4:148177820-148177842 AAGACTGAGGATAAGTTCTGGGG - Intronic
982270092 4:153577657-153577679 AAGAAAGAGGAGAAGTGAGTGGG + Intronic
982397447 4:154927416-154927438 TAGACTGAGAAGAAGTGGTCAGG - Intergenic
982819194 4:159925509-159925531 AAGAATGAAGAGAAGTATTTAGG - Intergenic
983089106 4:163483447-163483469 AAGATTGAGAAGAAGGAGTGAGG + Intergenic
983188834 4:164732802-164732824 AAGGATGAGGAGGAGTTCTGCGG + Intergenic
984094070 4:175412284-175412306 AAGAATAAGCAGAAGTCCTGGGG - Intergenic
984259874 4:177432191-177432213 AAGAATAGGGAGCAATGGTGGGG - Intronic
985117353 4:186605248-186605270 AAGGAAGAGGAGGAGTGGGGAGG + Intronic
986091905 5:4516942-4516964 AAGAAGGAAGAGAAGGAGTGGGG - Intergenic
986874928 5:12096126-12096148 AAGAATGAGAGGCAGTGGGGTGG + Intergenic
987171268 5:15260924-15260946 TATAATGAGGTGAAGGGGTGAGG + Intergenic
987896106 5:23949406-23949428 AAGAAGGAGGAGGAGTGGGAGGG - Intergenic
988623202 5:32844544-32844566 TAGAATGAGGAGGGGTGGTCAGG + Intergenic
990006782 5:50953622-50953644 AAGAAAGAAGAGAAGGGGAGAGG - Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
991972967 5:72158451-72158473 AAGAAAGAGGAGAGGTGTTTGGG + Intronic
992572600 5:78075164-78075186 GAGAGTGAGGAGAACTGGTAGGG + Intronic
993945041 5:94108725-94108747 AAGGATGTGGAGAAATGGTGAGG + Intronic
994150571 5:96442932-96442954 AAGAATGAGAAGAAATGGAGGGG - Intergenic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
994993043 5:107022213-107022235 ATGGATGAGGATAAGTGGTCTGG - Intergenic
995541595 5:113191237-113191259 AAAAATGTGGAGTACTGGTGCGG - Intronic
995959041 5:117816947-117816969 AAGAATAATGAAAAGAGGTGAGG - Intergenic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
998165800 5:139842875-139842897 AAGGAGGAGGAGAAAGGGTGGGG - Exonic
998231978 5:140366774-140366796 GAGAGTGAGGAGTAGTGGAGTGG - Intronic
998590236 5:143470584-143470606 AATAATGAGGCCAAGTGGGGGGG - Intergenic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999770135 5:154769445-154769467 AAGAATGAGAGGAGGCGGTGGGG + Intronic
1001106190 5:168856676-168856698 CAAAAGGAGGAGCAGTGGTGTGG - Intronic
1001195460 5:169669500-169669522 AAGAATGAGGGAAAGTGGGAGGG - Intronic
1002082113 5:176743384-176743406 AGGAAGGAGGCGAAGCGGTGCGG + Intergenic
1002444622 5:179281800-179281822 AAGAATAATGAGTATTGGTGGGG - Intronic
1002642409 5:180636502-180636524 GAGAATGAGGGGAAGTGACGGGG - Intronic
1003701143 6:8466571-8466593 AAGCATGAGAAGAAATGGAGAGG + Intergenic
1003857342 6:10289974-10289996 CAGAATGAGGGGCAGTGATGTGG - Intergenic
1004071803 6:12305523-12305545 AAGAATGAGGAGATATTTTGAGG + Intergenic
1004202159 6:13558820-13558842 AAGCAGTGGGAGAAGTGGTGTGG + Intergenic
1006283638 6:33076744-33076766 AAGAATGAGATGAGGTTGTGTGG + Intronic
1006625396 6:35394097-35394119 GAGAATGAGGGGGACTGGTGGGG - Intronic
1006833265 6:36981724-36981746 AGGTGTGAGGAGAGGTGGTGAGG - Intronic
1007050182 6:38819666-38819688 AAAAATGAGAAGAATTGGAGAGG + Intronic
1007330166 6:41100858-41100880 AAGAATGTGGGAAGGTGGTGGGG + Intergenic
1007645012 6:43373109-43373131 ATGAATTTGGAGTAGTGGTGGGG - Intergenic
1008495952 6:52134381-52134403 AAGAATGAGCAGACTTGCTGAGG - Intergenic
1009866154 6:69400013-69400035 AAGAATGGGGAAAAGAGGAGGGG + Intergenic
1011003211 6:82614834-82614856 AAGTATGAGGAAAAGTGTGGAGG + Intergenic
1011140571 6:84151078-84151100 AAGAATGAGGAAAAGGCATGAGG + Intronic
1012491622 6:99788626-99788648 AAGAAGGAGGAGAAATGAAGGGG - Intergenic
1012748888 6:103131931-103131953 AGAAGTGAGGAGAAATGGTGAGG + Intergenic
1013141589 6:107341349-107341371 AAGAAGGAGGAGAACTAATGAGG + Intronic
1013458414 6:110353422-110353444 AAGAAAGAGGAAAAATGGTATGG - Intronic
1014279846 6:119429622-119429644 AAGAAGCAGCAGAAGTCGTGAGG + Intergenic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1015731867 6:136357294-136357316 AATAATGAGGTGGAATGGTGAGG - Intronic
1016089259 6:139955865-139955887 AAGACTGACGAGAACTGGAGTGG + Intergenic
1016282089 6:142429903-142429925 AAAAATTAGGTGTAGTGGTGTGG + Intronic
1016417767 6:143851019-143851041 AAGAAGGAGGGGGAGGGGTGGGG + Intronic
1016510353 6:144835887-144835909 AAGAACGTGGAGAACTGGAGAGG + Exonic
1017972970 6:159329114-159329136 AAAAAAGAGGGGAGGTGGTGGGG + Intergenic
1017991736 6:159494937-159494959 AAGAATTAGGAGATGAGGTGGGG - Intergenic
1018550644 6:164994310-164994332 AAGAATGTGGATATGTGGAGGGG - Intergenic
1019526368 7:1482227-1482249 GAGGAGGAGGAGAAGTGGTGGGG - Intronic
1019794744 7:3041363-3041385 AAGAATTAGGAGGAGTGGGAAGG - Intronic
1020209653 7:6149098-6149120 GAGAATGTGGAGACGTTGTGGGG + Intronic
1020851485 7:13359572-13359594 GAGAATGACGTGAACTGGTGAGG - Intergenic
1021280228 7:18708094-18708116 AAAAATGAGGAAAAGAGGTAAGG + Intronic
1021381081 7:19967224-19967246 ACGACTGACTAGAAGTGGTGTGG - Intergenic
1021827217 7:24567229-24567251 AGGACTGAGGAGAAGTCGTGAGG - Intergenic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1023529048 7:41134619-41134641 AAGAATGAGAAGGAAAGGTGTGG - Intergenic
1023607665 7:41944685-41944707 AGGAATGTGGAGAAGTGGTGAGG + Intergenic
1023707700 7:42959523-42959545 TAGAGTGAGGAAAAATGGTGTGG + Intergenic
1024352698 7:48382996-48383018 AAGAATGAGTAGGACAGGTGAGG - Intronic
1024721004 7:52137366-52137388 AAGAAGGAGGAGGAGGGGGGAGG + Intergenic
1025091634 7:56068997-56069019 AAGAATGAGGCCAAGTGCAGTGG - Intronic
1025231698 7:57207068-57207090 AAGAAAGAGGAGAGGAGGGGAGG - Intergenic
1026301651 7:69103088-69103110 AAGAAGGCGGAGAAGAGGAGAGG - Intergenic
1026679033 7:72451378-72451400 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1027343908 7:77237990-77238012 AAGAAGGAGGGGAAGTGATTGGG - Intronic
1028015957 7:85712644-85712666 AAGAATGATGAGAAGTGTAAAGG + Intergenic
1028849353 7:95518977-95518999 AAGAATGAGGTGCACAGGTGAGG + Intronic
1029026582 7:97423269-97423291 AAGAGAGAGGAGTAGGGGTGAGG - Intergenic
1029560741 7:101301033-101301055 AGAAATGAGGAAAAGAGGTGGGG + Intergenic
1029645155 7:101850349-101850371 GAGAGTGGGGAGAAGTGGGGTGG - Intronic
1029716252 7:102328462-102328484 AAGAATGAGGAAATGAGGAGGGG + Intergenic
1030106147 7:105989220-105989242 CAGAAAGTGGAGAAGAGGTGGGG - Intronic
1030825149 7:114146907-114146929 AACAATGAGTAGAAATGGTTAGG - Intronic
1030987597 7:116260946-116260968 AAGTATGTGGAGAAGTATTGTGG + Intergenic
1031063731 7:117081271-117081293 AAGAATGAGAAGAAGTTCTTAGG - Intronic
1031257754 7:119478327-119478349 AAGAATGAGCAGAAATAGAGTGG + Intergenic
1033832636 7:145271798-145271820 GAGAAGGAGGAGAAGAGGAGGGG + Intergenic
1034083170 7:148299314-148299336 AAGAATGAGTAGAAGTAGCCAGG + Intronic
1034085352 7:148317407-148317429 AAGAATCAGGCCAAGTGCTGAGG + Intronic
1034275844 7:149823532-149823554 AAGAAGGAGGAGCAGGAGTGTGG - Intergenic
1034952992 7:155313543-155313565 CAGAATGAGGAGAAAAGGGGAGG - Intergenic
1035684033 8:1509668-1509690 AAGAATGAGAAGAACAGGAGAGG - Intronic
1035978815 8:4345079-4345101 TAGAAAGAGGAGAAATGATGGGG + Intronic
1036467151 8:9010034-9010056 AAGAATGAATCGAAGTGTTGTGG + Intronic
1036602356 8:10273628-10273650 AAGAATGAGAAGAAGTGAGATGG - Intronic
1036642672 8:10593816-10593838 AAGAAAGAGGAGAGCTGGGGTGG - Intergenic
1037124077 8:15323835-15323857 AAGAAGGGGAACAAGTGGTGGGG + Intergenic
1037409180 8:18576754-18576776 TGGAATGAGGAGAAATGATGAGG + Intronic
1037753804 8:21698897-21698919 AAGAATCGGGAGAATGGGTGTGG - Intronic
1037981084 8:23254925-23254947 AAGACTGAGGAGGTGAGGTGAGG - Intronic
1038640437 8:29320269-29320291 AAGAAGGGGGAGATGTGGCGGGG + Intergenic
1039193030 8:34998626-34998648 AACAAAGAGGAAAAGTGGTGAGG + Intergenic
1039233105 8:35470820-35470842 AAGAATGAGCAGAGTTGGTATGG + Intronic
1040752471 8:50727668-50727690 AAGAATGAGGAGTGGAGGAGGGG - Intronic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042181411 8:66091388-66091410 AAGAAGGAGGAGGAGTTGAGGGG + Intronic
1043305715 8:78791771-78791793 CAGACTGTAGAGAAGTGGTGGGG - Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044543481 8:93433592-93433614 AAGAATGGGAAGAAGAGGTTGGG - Intergenic
1044643043 8:94405360-94405382 AAGAATGAGGAGATGAGAAGAGG + Intronic
1045590877 8:103595546-103595568 AAGTAAGAAGAGAAGTGTTGGGG + Intronic
1045697463 8:104825969-104825991 AGGAATGAGTAGAAATGTTGTGG + Intronic
1045899513 8:107260540-107260562 GAGAATAAGTAGTAGTGGTGGGG + Intronic
1046705953 8:117451941-117451963 AAAAATAAGGAATAGTGGTGAGG + Intergenic
1046924670 8:119773408-119773430 AAGAATGGGGAGAAAGGGTTGGG - Intronic
1047186279 8:122636308-122636330 TAGAATGGAGAGAGGTGGTGGGG - Intergenic
1049298573 8:141856764-141856786 CAGACTGAGGACAAGAGGTGGGG + Intergenic
1049444658 8:142624448-142624470 CAGAAAGAGGAGGAGTGGAGAGG + Intergenic
1050942181 9:11473235-11473257 AAGATGAAGGAGAAGTGGAGAGG + Intergenic
1051371198 9:16360568-16360590 CAGAATGAGGAGAAAGGCTGAGG - Intergenic
1051632106 9:19149931-19149953 AAGAAAGAAGAAAAGTGGAGTGG + Intergenic
1052896492 9:33751818-33751840 AAGAATCAGGACACGTGGTTAGG + Intronic
1053216215 9:36272773-36272795 AAGAATGTGGAGAAGGGGCCGGG + Intronic
1053487748 9:38472726-38472748 AACCAGGAGGAAAAGTGGTGAGG - Intergenic
1053654209 9:40198276-40198298 AAGAAGGTGGGGAAATGGTGGGG + Intergenic
1053904595 9:42827451-42827473 AAGAAGGTGGGGAAATGGTGGGG + Intergenic
1054530388 9:66178063-66178085 AAGAAGGTGGGGAAATGGTGGGG - Intergenic
1056147495 9:83747376-83747398 AAGTATGAAGAGCAGTGGGGAGG + Intronic
1056368410 9:85929503-85929525 AAGAAGGTTGGGAAGTGGTGGGG - Intergenic
1057379746 9:94556481-94556503 AAGAAGGTGGGGAAATGGTGGGG + Intergenic
1057982827 9:99679491-99679513 AGGAATGAGGAGATGTAGTTGGG + Intergenic
1058295642 9:103303436-103303458 AAGAATGAGGATACATGGTCGGG + Intergenic
1059082369 9:111264194-111264216 GAGAATGAGAAGAGGTAGTGTGG - Intergenic
1059517969 9:114913418-114913440 TTGAATGAGGTGAAGTGCTGAGG - Intronic
1061556744 9:131374947-131374969 AACAATGAAGTGAAGTGTTGTGG - Intergenic
1061582881 9:131548211-131548233 AGGAAAGTGGAGAAGGGGTGGGG - Intergenic
1062243641 9:135552500-135552522 ATGAATGAAGTCAAGTGGTGTGG + Intergenic
1062312111 9:135944499-135944521 AAGAATGGGGAGATGAGGCGCGG + Intronic
1203386549 Un_KI270438v1:60745-60767 ATGAATGCGGAGAAGCGGAGTGG + Intergenic
1203343096 Un_KI270442v1:12083-12105 AGGAATGTGGTGAAGTGGAGTGG + Intergenic
1203343157 Un_KI270442v1:12433-12455 AGGAATGCGGAGAAGCGGAGTGG + Intergenic
1203349192 Un_KI270442v1:61740-61762 TGGAATGAGGTGAAGTGGAGTGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186539380 X:10384540-10384562 AAGAATGAGGAGTGGTTGTGAGG + Intergenic
1186822892 X:13309553-13309575 AAGATTGGGGAAAAGTGGAGTGG + Intergenic
1187661827 X:21556025-21556047 AAAAATGAAGAGTATTGGTGAGG + Intronic
1189270202 X:39746280-39746302 CAGAAGGGGGAGACGTGGTGAGG - Intergenic
1189824685 X:44906133-44906155 AAGATGGAGGAGAAGTATTGAGG - Intronic
1190487520 X:50942507-50942529 AGGCATGAGGAGGAGTGGGGAGG + Intergenic
1190515908 X:51223395-51223417 AAGATTGAAGAGAAGGAGTGGGG - Intergenic
1191071446 X:56404915-56404937 AGGGATGTGGAGGAGTGGTGTGG + Intergenic
1194399343 X:93423335-93423357 AATAAAGAGGAGCAGTTGTGGGG + Intergenic
1194754205 X:97718187-97718209 AAGGAGGTGGAGAGGTGGTGGGG - Intergenic
1194925711 X:99820486-99820508 AACACTGGGGAGAGGTGGTGAGG - Intergenic
1194992903 X:100564044-100564066 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1195291355 X:103434184-103434206 AGGAAAGTGGAGAAGGGGTGGGG + Intergenic
1195327043 X:103766358-103766380 AGGAAAGTGGAGAAGGGGTGGGG + Intergenic
1195778184 X:108431256-108431278 AAGTATAAGGAGAACTAGTGAGG + Intronic
1196167872 X:112555336-112555358 GAGAGTGAGGAAAAGTGGGGTGG + Intergenic
1196227832 X:113187844-113187866 AAGAAGGAGGAGAAGTGATGTGG + Intergenic
1196318970 X:114266392-114266414 AGGAATGAAGAGAAGCGGAGTGG + Intergenic
1197784588 X:130187394-130187416 AAGAAAGAGGAGGAGAGGGGAGG - Intergenic
1198645954 X:138806774-138806796 AAGTATGAGGAGAAGATCTGGGG + Intronic
1199053114 X:143260878-143260900 AAGAATAATGAGAAGAGGCGGGG + Intergenic
1199430471 X:147753915-147753937 AGGGATAAGGAGAAGTGATGTGG - Intergenic
1199564461 X:149199517-149199539 AAGAGTGAGGAAAAGTAGAGTGG - Intergenic
1199765402 X:150937593-150937615 AAGCAGAAGGAGAAGTGATGTGG - Intergenic
1200007075 X:153093909-153093931 TAGCCTGAGGAGAAGTGGAGAGG + Intergenic
1201107903 Y:10777117-10777139 AGGAATGGAGAGAAGTGGTGTGG - Intergenic
1201110547 Y:10796201-10796223 CAGAATGGGGAGCAGTGGAGTGG - Intergenic
1201110788 Y:10797845-10797867 AAGAACGGAGAGAAGTGTTGAGG - Intergenic
1201115825 Y:10834650-10834672 AAGAATGGAGAGAAGAGGTGTGG - Intergenic
1201124379 Y:10900152-10900174 AGGAATGGAGAGAAGTGGAGTGG - Intergenic
1201620470 Y:15951474-15951496 AGGAATGAGTAGAAGTGTAGGGG - Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202605753 Y:26638491-26638513 TGGAATGCGGAGAAGTGGAGTGG + Intergenic
1202606293 Y:26642393-26642415 TGGAATGAGGTGAAGTGGAGTGG + Intergenic