ID: 1070250111

View in Genome Browser
Species Human (GRCh38)
Location 10:74766105-74766127
Sequence GCTGCAGATCCACTGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250111_1070250114 -9 Left 1070250111 10:74766105-74766127 CCTTCTCCCAGTGGATCTGCAGC No data
Right 1070250114 10:74766119-74766141 ATCTGCAGCCCCTCCCACAGTGG No data
1070250111_1070250125 27 Left 1070250111 10:74766105-74766127 CCTTCTCCCAGTGGATCTGCAGC No data
Right 1070250125 10:74766155-74766177 GCCCAGCCCTCCCCTTGCACTGG No data
1070250111_1070250127 28 Left 1070250111 10:74766105-74766127 CCTTCTCCCAGTGGATCTGCAGC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250111_1070250129 29 Left 1070250111 10:74766105-74766127 CCTTCTCCCAGTGGATCTGCAGC No data
Right 1070250129 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data
1070250111_1070250115 -8 Left 1070250111 10:74766105-74766127 CCTTCTCCCAGTGGATCTGCAGC No data
Right 1070250115 10:74766120-74766142 TCTGCAGCCCCTCCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250111 Original CRISPR GCTGCAGATCCACTGGGAGA AGG (reversed) Intergenic