ID: 1070250112

View in Genome Browser
Species Human (GRCh38)
Location 10:74766111-74766133
Sequence GGAGGGGCTGCAGATCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250112_1070250129 23 Left 1070250112 10:74766111-74766133 CCCAGTGGATCTGCAGCCCCTCC No data
Right 1070250129 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data
1070250112_1070250127 22 Left 1070250112 10:74766111-74766133 CCCAGTGGATCTGCAGCCCCTCC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250112_1070250125 21 Left 1070250112 10:74766111-74766133 CCCAGTGGATCTGCAGCCCCTCC No data
Right 1070250125 10:74766155-74766177 GCCCAGCCCTCCCCTTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250112 Original CRISPR GGAGGGGCTGCAGATCCACT GGG (reversed) Intergenic