ID: 1070250113

View in Genome Browser
Species Human (GRCh38)
Location 10:74766112-74766134
Sequence GGGAGGGGCTGCAGATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250113_1070250127 21 Left 1070250113 10:74766112-74766134 CCAGTGGATCTGCAGCCCCTCCC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250113_1070250125 20 Left 1070250113 10:74766112-74766134 CCAGTGGATCTGCAGCCCCTCCC No data
Right 1070250125 10:74766155-74766177 GCCCAGCCCTCCCCTTGCACTGG No data
1070250113_1070250129 22 Left 1070250113 10:74766112-74766134 CCAGTGGATCTGCAGCCCCTCCC No data
Right 1070250129 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250113 Original CRISPR GGGAGGGGCTGCAGATCCAC TGG (reversed) Intergenic