ID: 1070250116

View in Genome Browser
Species Human (GRCh38)
Location 10:74766127-74766149
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250116_1070250125 5 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250125 10:74766155-74766177 GCCCAGCCCTCCCCTTGCACTGG No data
1070250116_1070250136 23 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250116_1070250134 16 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250116_1070250137 24 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250137 10:74766174-74766196 CTGGGGTCTGCTTGGCACCTGGG No data
1070250116_1070250127 6 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250116_1070250129 7 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250129 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250116 Original CRISPR TACAGGGCCCACTGTGGGAG GGG (reversed) Intergenic