ID: 1070250121

View in Genome Browser
Species Human (GRCh38)
Location 10:74766143-74766165
Sequence GAGGGCTGGGCGGGAGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250121_1070250127 -10 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250121_1070250137 8 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250137 10:74766174-74766196 CTGGGGTCTGCTTGGCACCTGGG No data
1070250121_1070250129 -9 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250129 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data
1070250121_1070250136 7 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250121_1070250134 0 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250121_1070250139 27 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250121 Original CRISPR GAGGGCTGGGCGGGAGTACA GGG (reversed) Intergenic