ID: 1070250122

View in Genome Browser
Species Human (GRCh38)
Location 10:74766144-74766166
Sequence GGAGGGCTGGGCGGGAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250122_1070250136 6 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250122_1070250139 26 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250122_1070250129 -10 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250129 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data
1070250122_1070250134 -1 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250122_1070250137 7 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250137 10:74766174-74766196 CTGGGGTCTGCTTGGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250122 Original CRISPR GGAGGGCTGGGCGGGAGTAC AGG (reversed) Intergenic
No off target data available for this crispr