ID: 1070250124

View in Genome Browser
Species Human (GRCh38)
Location 10:74766153-74766175
Sequence AGTGCAAGGGGAGGGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250124_1070250139 17 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250124_1070250136 -3 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250124_1070250137 -2 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250137 10:74766174-74766196 CTGGGGTCTGCTTGGCACCTGGG No data
1070250124_1070250134 -10 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250124 Original CRISPR AGTGCAAGGGGAGGGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr