ID: 1070250126

View in Genome Browser
Species Human (GRCh38)
Location 10:74766156-74766178
Sequence CCCAGTGCAAGGGGAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250126_1070250139 14 Left 1070250126 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250126_1070250136 -6 Left 1070250126 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250126_1070250137 -5 Left 1070250126 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
Right 1070250137 10:74766174-74766196 CTGGGGTCTGCTTGGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250126 Original CRISPR CCCAGTGCAAGGGGAGGGCT GGG (reversed) Intergenic
No off target data available for this crispr