ID: 1070250127

View in Genome Browser
Species Human (GRCh38)
Location 10:74766156-74766178
Sequence CCCAGCCCTCCCCTTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250116_1070250127 6 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250120_1070250127 0 Left 1070250120 10:74766133-74766155 CCACAGTGGGCCCTGTACTCCCG No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250113_1070250127 21 Left 1070250113 10:74766112-74766134 CCAGTGGATCTGCAGCCCCTCCC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250121_1070250127 -10 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250111_1070250127 28 Left 1070250111 10:74766105-74766127 CCTTCTCCCAGTGGATCTGCAGC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250119_1070250127 1 Left 1070250119 10:74766132-74766154 CCCACAGTGGGCCCTGTACTCCC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250112_1070250127 22 Left 1070250112 10:74766111-74766133 CCCAGTGGATCTGCAGCCCCTCC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250117_1070250127 5 Left 1070250117 10:74766128-74766150 CCCTCCCACAGTGGGCCCTGTAC No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
1070250118_1070250127 4 Left 1070250118 10:74766129-74766151 CCTCCCACAGTGGGCCCTGTACT No data
Right 1070250127 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250127 Original CRISPR CCCAGCCCTCCCCTTGCACT GGG Intergenic
No off target data available for this crispr