ID: 1070250134

View in Genome Browser
Species Human (GRCh38)
Location 10:74766166-74766188
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250121_1070250134 0 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250122_1070250134 -1 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250119_1070250134 11 Left 1070250119 10:74766132-74766154 CCCACAGTGGGCCCTGTACTCCC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250116_1070250134 16 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250120_1070250134 10 Left 1070250120 10:74766133-74766155 CCACAGTGGGCCCTGTACTCCCG No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250118_1070250134 14 Left 1070250118 10:74766129-74766151 CCTCCCACAGTGGGCCCTGTACT No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250117_1070250134 15 Left 1070250117 10:74766128-74766150 CCCTCCCACAGTGGGCCCTGTAC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250124_1070250134 -10 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
1070250123_1070250134 -9 Left 1070250123 10:74766152-74766174 CCCGCCCAGCCCTCCCCTTGCAC No data
Right 1070250134 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250134 Original CRISPR CCCTTGCACTGGGGTCTGCT TGG Intergenic