ID: 1070250136

View in Genome Browser
Species Human (GRCh38)
Location 10:74766173-74766195
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250124_1070250136 -3 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250128_1070250136 -7 Left 1070250128 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250126_1070250136 -6 Left 1070250126 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250123_1070250136 -2 Left 1070250123 10:74766152-74766174 CCCGCCCAGCCCTCCCCTTGCAC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250117_1070250136 22 Left 1070250117 10:74766128-74766150 CCCTCCCACAGTGGGCCCTGTAC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250116_1070250136 23 Left 1070250116 10:74766127-74766149 CCCCTCCCACAGTGGGCCCTGTA No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250121_1070250136 7 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250119_1070250136 18 Left 1070250119 10:74766132-74766154 CCCACAGTGGGCCCTGTACTCCC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250122_1070250136 6 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250118_1070250136 21 Left 1070250118 10:74766129-74766151 CCTCCCACAGTGGGCCCTGTACT No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data
1070250120_1070250136 17 Left 1070250120 10:74766133-74766155 CCACAGTGGGCCCTGTACTCCCG No data
Right 1070250136 10:74766173-74766195 ACTGGGGTCTGCTTGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250136 Original CRISPR ACTGGGGTCTGCTTGGCACC TGG Intergenic