ID: 1070250139

View in Genome Browser
Species Human (GRCh38)
Location 10:74766193-74766215
Sequence TGGGACAGAGTTTTGTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070250135_1070250139 3 Left 1070250135 10:74766167-74766189 CCTTGCACTGGGGTCTGCTTGGC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250124_1070250139 17 Left 1070250124 10:74766153-74766175 CCGCCCAGCCCTCCCCTTGCACT No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250122_1070250139 26 Left 1070250122 10:74766144-74766166 CCTGTACTCCCGCCCAGCCCTCC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250128_1070250139 13 Left 1070250128 10:74766157-74766179 CCAGCCCTCCCCTTGCACTGGGG No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250126_1070250139 14 Left 1070250126 10:74766156-74766178 CCCAGCCCTCCCCTTGCACTGGG No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250133_1070250139 4 Left 1070250133 10:74766166-74766188 CCCTTGCACTGGGGTCTGCTTGG No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250131_1070250139 8 Left 1070250131 10:74766162-74766184 CCTCCCCTTGCACTGGGGTCTGC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250123_1070250139 18 Left 1070250123 10:74766152-74766174 CCCGCCCAGCCCTCCCCTTGCAC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250130_1070250139 9 Left 1070250130 10:74766161-74766183 CCCTCCCCTTGCACTGGGGTCTG No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250132_1070250139 5 Left 1070250132 10:74766165-74766187 CCCCTTGCACTGGGGTCTGCTTG No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data
1070250121_1070250139 27 Left 1070250121 10:74766143-74766165 CCCTGTACTCCCGCCCAGCCCTC No data
Right 1070250139 10:74766193-74766215 TGGGACAGAGTTTTGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070250139 Original CRISPR TGGGACAGAGTTTTGTTCAC TGG Intergenic