ID: 1070252473

View in Genome Browser
Species Human (GRCh38)
Location 10:74784960-74784982
Sequence CACATGGAGGTTCCTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070252466_1070252473 17 Left 1070252466 10:74784920-74784942 CCCAAGAGGACAGGTTTCTGAGA No data
Right 1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG No data
1070252464_1070252473 29 Left 1070252464 10:74784908-74784930 CCTCTATAAAAACCCAAGAGGAC No data
Right 1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG No data
1070252467_1070252473 16 Left 1070252467 10:74784921-74784943 CCAAGAGGACAGGTTTCTGAGAG No data
Right 1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070252473 Original CRISPR CACATGGAGGTTCCTGGAGA GGG Intergenic
No off target data available for this crispr