ID: 1070255927

View in Genome Browser
Species Human (GRCh38)
Location 10:74813316-74813338
Sequence GGGTGCACTCAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070255919_1070255927 3 Left 1070255919 10:74813290-74813312 CCTGGAGACCCAAGTCCAGGGGC No data
Right 1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG No data
1070255917_1070255927 4 Left 1070255917 10:74813289-74813311 CCCTGGAGACCCAAGTCCAGGGG No data
Right 1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG No data
1070255912_1070255927 21 Left 1070255912 10:74813272-74813294 CCGGGTCCTTGGCTTTACCCTGG No data
Right 1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG No data
1070255922_1070255927 -5 Left 1070255922 10:74813298-74813320 CCCAAGTCCAGGGGCCTTGGGTG No data
Right 1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG No data
1070255914_1070255927 15 Left 1070255914 10:74813278-74813300 CCTTGGCTTTACCCTGGAGACCC No data
Right 1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG No data
1070255923_1070255927 -6 Left 1070255923 10:74813299-74813321 CCAAGTCCAGGGGCCTTGGGTGC No data
Right 1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070255927 Original CRISPR GGGTGCACTCAGATGGAGAA AGG Intergenic
No off target data available for this crispr