ID: 1070256442

View in Genome Browser
Species Human (GRCh38)
Location 10:74816864-74816886
Sequence TGCTCCATGCAGTTACTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070256436_1070256442 9 Left 1070256436 10:74816832-74816854 CCTGTTACATATCAGAACAAGTG No data
Right 1070256442 10:74816864-74816886 TGCTCCATGCAGTTACTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070256442 Original CRISPR TGCTCCATGCAGTTACTTAG GGG Intergenic
No off target data available for this crispr