ID: 1070257538

View in Genome Browser
Species Human (GRCh38)
Location 10:74825294-74825316
Sequence GCGGAGACGCTGGTGTCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070257538_1070257543 -7 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257543 10:74825310-74825332 TCTCCGCCCTCCCCCGAGGGCGG No data
1070257538_1070257554 12 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257554 10:74825329-74825351 GCGGCGAGAGGAGCCCCCCGGGG No data
1070257538_1070257557 22 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257557 10:74825339-74825361 GAGCCCCCCGGGGCGGAGGCAGG No data
1070257538_1070257556 18 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257556 10:74825335-74825357 AGAGGAGCCCCCCGGGGCGGAGG No data
1070257538_1070257547 0 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257547 10:74825317-74825339 CCTCCCCCGAGGGCGGCGAGAGG No data
1070257538_1070257552 10 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257552 10:74825327-74825349 GGGCGGCGAGAGGAGCCCCCCGG No data
1070257538_1070257553 11 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257538_1070257542 -10 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257538_1070257555 15 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070257538 Original CRISPR GCGGAGACGCTGGTGTCCGC GGG (reversed) Intergenic