ID: 1070257542

View in Genome Browser
Species Human (GRCh38)
Location 10:74825307-74825329
Sequence GCGTCTCCGCCCTCCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070257532_1070257542 7 Left 1070257532 10:74825277-74825299 CCAGGCGTCCCCATCCTCCCGCG No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257538_1070257542 -10 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257537_1070257542 -7 Left 1070257537 10:74825291-74825313 CCTCCCGCGGACACCAGCGTCTC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257530_1070257542 16 Left 1070257530 10:74825268-74825290 CCAAACGGCCCAGGCGTCCCCAT No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257531_1070257542 8 Left 1070257531 10:74825276-74825298 CCCAGGCGTCCCCATCCTCCCGC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257528_1070257542 18 Left 1070257528 10:74825266-74825288 CCCCAAACGGCCCAGGCGTCCCC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257534_1070257542 -1 Left 1070257534 10:74825285-74825307 CCCCATCCTCCCGCGGACACCAG No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257536_1070257542 -3 Left 1070257536 10:74825287-74825309 CCATCCTCCCGCGGACACCAGCG No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257525_1070257542 23 Left 1070257525 10:74825261-74825283 CCCCGCCCCAAACGGCCCAGGCG No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257535_1070257542 -2 Left 1070257535 10:74825286-74825308 CCCATCCTCCCGCGGACACCAGC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257526_1070257542 22 Left 1070257526 10:74825262-74825284 CCCGCCCCAAACGGCCCAGGCGT No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257529_1070257542 17 Left 1070257529 10:74825267-74825289 CCCAAACGGCCCAGGCGTCCCCA No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data
1070257527_1070257542 21 Left 1070257527 10:74825263-74825285 CCGCCCCAAACGGCCCAGGCGTC No data
Right 1070257542 10:74825307-74825329 GCGTCTCCGCCCTCCCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070257542 Original CRISPR GCGTCTCCGCCCTCCCCCGA GGG Intergenic