ID: 1070257553

View in Genome Browser
Species Human (GRCh38)
Location 10:74825328-74825350
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070257539_1070257553 10 Left 1070257539 10:74825295-74825317 CCGCGGACACCAGCGTCTCCGCC No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257538_1070257553 11 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257540_1070257553 1 Left 1070257540 10:74825304-74825326 CCAGCGTCTCCGCCCTCCCCCGA No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257536_1070257553 18 Left 1070257536 10:74825287-74825309 CCATCCTCCCGCGGACACCAGCG No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257534_1070257553 20 Left 1070257534 10:74825285-74825307 CCCCATCCTCCCGCGGACACCAG No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257531_1070257553 29 Left 1070257531 10:74825276-74825298 CCCAGGCGTCCCCATCCTCCCGC No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257544_1070257553 -8 Left 1070257544 10:74825313-74825335 CCGCCCTCCCCCGAGGGCGGCGA No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257535_1070257553 19 Left 1070257535 10:74825286-74825308 CCCATCCTCCCGCGGACACCAGC No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257532_1070257553 28 Left 1070257532 10:74825277-74825299 CCAGGCGTCCCCATCCTCCCGCG No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data
1070257537_1070257553 14 Left 1070257537 10:74825291-74825313 CCTCCCGCGGACACCAGCGTCTC No data
Right 1070257553 10:74825328-74825350 GGCGGCGAGAGGAGCCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070257553 Original CRISPR GGCGGCGAGAGGAGCCCCCC GGG Intergenic