ID: 1070257555

View in Genome Browser
Species Human (GRCh38)
Location 10:74825332-74825354
Sequence GCGAGAGGAGCCCCCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070257536_1070257555 22 Left 1070257536 10:74825287-74825309 CCATCCTCCCGCGGACACCAGCG No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257540_1070257555 5 Left 1070257540 10:74825304-74825326 CCAGCGTCTCCGCCCTCCCCCGA No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257546_1070257555 -8 Left 1070257546 10:74825317-74825339 CCTCCCCCGAGGGCGGCGAGAGG No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257545_1070257555 -7 Left 1070257545 10:74825316-74825338 CCCTCCCCCGAGGGCGGCGAGAG No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257539_1070257555 14 Left 1070257539 10:74825295-74825317 CCGCGGACACCAGCGTCTCCGCC No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257537_1070257555 18 Left 1070257537 10:74825291-74825313 CCTCCCGCGGACACCAGCGTCTC No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257535_1070257555 23 Left 1070257535 10:74825286-74825308 CCCATCCTCCCGCGGACACCAGC No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257534_1070257555 24 Left 1070257534 10:74825285-74825307 CCCCATCCTCCCGCGGACACCAG No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257544_1070257555 -4 Left 1070257544 10:74825313-74825335 CCGCCCTCCCCCGAGGGCGGCGA No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data
1070257538_1070257555 15 Left 1070257538 10:74825294-74825316 CCCGCGGACACCAGCGTCTCCGC No data
Right 1070257555 10:74825332-74825354 GCGAGAGGAGCCCCCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070257555 Original CRISPR GCGAGAGGAGCCCCCCGGGG CGG Intergenic