ID: 1070257761 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:74825965-74825987 |
Sequence | GTGCGGACGGGCGCGCCGCC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070257761_1070257766 | -4 | Left | 1070257761 | 10:74825965-74825987 | CCGGGCGGCGCGCCCGTCCGCAC | No data | ||
Right | 1070257766 | 10:74825984-74826006 | GCACACTCCACCGAAGGAGCTGG | 0: 1 1: 0 2: 0 3: 8 4: 102 |
||||
1070257761_1070257764 | -10 | Left | 1070257761 | 10:74825965-74825987 | CCGGGCGGCGCGCCCGTCCGCAC | No data | ||
Right | 1070257764 | 10:74825978-74826000 | CCGTCCGCACACTCCACCGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070257761 | Original CRISPR | GTGCGGACGGGCGCGCCGCC CGG (reversed) | Intronic | ||