ID: 1070257761

View in Genome Browser
Species Human (GRCh38)
Location 10:74825965-74825987
Sequence GTGCGGACGGGCGCGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070257761_1070257764 -10 Left 1070257761 10:74825965-74825987 CCGGGCGGCGCGCCCGTCCGCAC No data
Right 1070257764 10:74825978-74826000 CCGTCCGCACACTCCACCGAAGG No data
1070257761_1070257766 -4 Left 1070257761 10:74825965-74825987 CCGGGCGGCGCGCCCGTCCGCAC No data
Right 1070257766 10:74825984-74826006 GCACACTCCACCGAAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070257761 Original CRISPR GTGCGGACGGGCGCGCCGCC CGG (reversed) Intronic