ID: 1070257764

View in Genome Browser
Species Human (GRCh38)
Location 10:74825978-74826000
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070257761_1070257764 -10 Left 1070257761 10:74825965-74825987 CCGGGCGGCGCGCCCGTCCGCAC No data
Right 1070257764 10:74825978-74826000 CCGTCCGCACACTCCACCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type