ID: 1070265055

View in Genome Browser
Species Human (GRCh38)
Location 10:74894040-74894062
Sequence AAGTTTCAGGCTAATTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070265055_1070265058 22 Left 1070265055 10:74894040-74894062 CCTTATGAATTAGCCTGAAACTT 0: 1
1: 0
2: 0
3: 8
4: 180
Right 1070265058 10:74894085-74894107 CTCTCTTTTTTCCCTTGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070265055 Original CRISPR AAGTTTCAGGCTAATTCATA AGG (reversed) Intronic
904084131 1:27892276-27892298 CATTTTCAGGCCAATTCAGAAGG + Intronic
905812819 1:40925500-40925522 AAGGTTCTGGCCAATGCATAAGG - Intergenic
908726004 1:67177816-67177838 CAGTTTCAGCCTTATGCATATGG + Intronic
908732855 1:67244510-67244532 CAGTTTCAGCCTTATGCATATGG + Intronic
910188489 1:84571395-84571417 AAGTTTCTGGCTACTGCAGATGG + Intronic
911498597 1:98659854-98659876 AAGTTTCATGGAAATTCCTAAGG - Intergenic
911961591 1:104310647-104310669 AAGTTTGAGGCTATTTGAGATGG + Intergenic
912904846 1:113693465-113693487 AATTTTGAGGCTCATTCATGTGG + Intergenic
915124375 1:153653277-153653299 CAGCTTCAGGCTGTTTCATAAGG + Intergenic
918198565 1:182245616-182245638 AAGTGTCAGACTAATTCAAGAGG - Intergenic
918542366 1:185646227-185646249 AAATATCATGCTAACTCATAAGG + Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
919213633 1:194521172-194521194 AAGTTTCAGGGCAATTCTTATGG + Intergenic
919243949 1:194952757-194952779 TAGTTTCAGTCTTATGCATATGG - Intergenic
921301759 1:213757802-213757824 TTGTTTCAGGCTAATGCATCTGG + Intergenic
922578744 1:226681297-226681319 AACTTTCTGGCTAAATCAAAGGG - Intronic
1063959023 10:11291212-11291234 AAGCTTCAGACAAATTCATCTGG + Intronic
1065419639 10:25528989-25529011 AAGTTTCAAGGTAATTCAACAGG + Intronic
1066125000 10:32332912-32332934 AAGTCTCATGGTATTTCATAAGG + Intronic
1070265055 10:74894040-74894062 AAGTTTCAGGCTAATTCATAAGG - Intronic
1076095318 10:127730312-127730334 AAGATTTAGCCTAATTCTTAAGG + Intergenic
1079821710 11:25139812-25139834 CAGTTTCCGGGTAATTAATAAGG + Intergenic
1083199134 11:61109204-61109226 AAGTTTCTGGCAAATGCATTTGG + Intronic
1085430318 11:76442517-76442539 AAGTTTGAGTCTAATCCTTAAGG + Intergenic
1086166092 11:83780406-83780428 AATTGTGAGGCTAATTCAGAAGG - Intronic
1086994642 11:93342171-93342193 ATTTTTCAGCCTACTTCATATGG + Intronic
1088237728 11:107743069-107743091 AAGTTTTTGGCTGATTCCTATGG - Intergenic
1091291983 11:134445761-134445783 AGGTTTCCGGCTAAGTCACACGG - Intergenic
1093209114 12:16286265-16286287 TAGTTTCATGCTTCTTCATATGG + Intergenic
1093292825 12:17349763-17349785 AATTCCCAGGCTAATTTATAGGG - Intergenic
1093517098 12:20001049-20001071 TAGTTTTGGGCTAAGTCATAAGG + Intergenic
1095196289 12:39322430-39322452 AAGTTTTAGGATCATTCTTAAGG - Intronic
1098176989 12:67803123-67803145 TAGATTCAGTCTAAGTCATATGG + Intergenic
1098283080 12:68881121-68881143 AGGGTTCAGGCTAATTCACCTGG - Intronic
1098481940 12:70972566-70972588 TAGTTTCAGTTTATTTCATATGG + Intergenic
1099571036 12:84318975-84318997 AAGTTTCAGTCTTCTGCATATGG - Intergenic
1102442402 12:112973743-112973765 TAGTTTCAGACCAATTCAGAAGG + Intergenic
1105569599 13:21589179-21589201 GAGTTGCAGGCTAACTCATTGGG - Intronic
1108901632 13:55416727-55416749 AAATTTTAGTCAAATTCATATGG - Intergenic
1109727476 13:66362376-66362398 AATTTTCAGGCTATTCCATCAGG + Intronic
1109889969 13:68598592-68598614 AATTATGAGGATAATTCATATGG + Intergenic
1111563790 13:89988455-89988477 TACTTTCAGACTAATTCATGTGG + Intergenic
1111577693 13:90179391-90179413 AAGTTTCATGATAATGCATCTGG - Intergenic
1112869896 13:103957619-103957641 ATCTTACAGGCAAATTCATAAGG + Intergenic
1114001792 14:18260728-18260750 AAGTTTCTAGCTAATTTTTATGG + Intergenic
1117012690 14:51486904-51486926 AAGTTTCAGGATAGTATATAGGG + Intergenic
1117249939 14:53926865-53926887 CAGTTTCAGGCTACATAATAGGG + Intergenic
1118201365 14:63677039-63677061 GAGTTTCAGGTTGATACATAAGG + Intergenic
1121647056 14:95525782-95525804 AAGATTCAGGCTTATTCCTAGGG - Intergenic
1122188082 14:100017241-100017263 ACCTTTCAGGGCAATTCATAAGG - Intronic
1125138718 15:36376823-36376845 AAGTTTCAGAGATATTCATAAGG - Intergenic
1125265445 15:37874513-37874535 AAATTTCAGGCTATTGCAAATGG + Intergenic
1125466141 15:39954613-39954635 AAATTTCAGGCAGATCCATATGG - Intronic
1126501037 15:49345608-49345630 AAGTATGAGGCCAATTCAGATGG - Intronic
1126831084 15:52606294-52606316 AAGAAACAGGCTAATTCTTAAGG + Intronic
1127038185 15:54943124-54943146 AAGTTGCAGGACAATACATATGG - Intergenic
1129092532 15:73166553-73166575 AAGTTATAGGCAAAATCATAAGG + Intronic
1130705323 15:86227745-86227767 CAGTATCAGCCTCATTCATATGG + Intronic
1133878764 16:9761126-9761148 AAATTTCAGGGTCAATCATAGGG - Exonic
1137337058 16:47559978-47560000 AAATTTCATGACAATTCATATGG - Intronic
1139931819 16:70533458-70533480 AATTTGCAGGCTAGTTCATACGG + Intronic
1148810846 17:50290123-50290145 AAGTTTCAGGCTAACAGAGAGGG + Intergenic
1149374130 17:56027018-56027040 ATGTTTCAGGATAATTCTTTAGG - Intergenic
1150175291 17:63048500-63048522 CAGTTTCAGTCTTCTTCATACGG + Intronic
1153371823 18:4325805-4325827 CAGTTTCAATCTAATGCATATGG - Intronic
1154078573 18:11230679-11230701 AAGTTTCAGTCTAAGTCTGAAGG - Intergenic
1155623057 18:27803185-27803207 AAGTTTAAGGATAACTAATATGG + Intergenic
1156289878 18:35737835-35737857 AAGTTTCAGTCTTCTGCATATGG - Intergenic
1158085403 18:53645182-53645204 AAGTTTGATGCAAATTCATCTGG + Intergenic
1159269664 18:66132234-66132256 AATTTTCATGCTTATTAATAAGG + Intergenic
1159344200 18:67177625-67177647 AAGCTTCAGGATGATTTATATGG + Intergenic
1159992612 18:74927665-74927687 AATTTTCAAGCTCTTTCATATGG - Intronic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1166601832 19:44102705-44102727 AAGCTCCAGGATAAGTCATATGG - Intronic
926719623 2:15949991-15950013 AGCTCTCAGGCTAATTCAGATGG + Intergenic
928693804 2:33827893-33827915 CAGTTTCAGTCTTCTTCATAGGG + Intergenic
929402833 2:41605336-41605358 AAGTTTCATGCTGATTTATAAGG + Intergenic
929419010 2:41771886-41771908 TAGTTTCATTGTAATTCATAGGG + Intergenic
930596442 2:53394765-53394787 AAGTTACAGGGTTATTCAAACGG - Intergenic
931912458 2:66915837-66915859 AAGTTTAAGGGTTATTCACAAGG - Intergenic
933002892 2:76949271-76949293 AAGTTTCTGGCTCTTTCACATGG + Intronic
935480578 2:103583211-103583233 AAAATTCAGACTATTTCATAGGG - Intergenic
935917972 2:107978409-107978431 CAGTTTCAGTTTTATTCATATGG - Intergenic
937165930 2:119817256-119817278 CAGTTTCAGCCTTATGCATATGG + Intronic
939964361 2:148596003-148596025 AAGTTTTATGCTAATTTTTATGG - Intergenic
941040125 2:160612069-160612091 AACTTTCTGGCACATTCATAAGG - Intergenic
941057454 2:160805464-160805486 AATTTTCAGGATAGATCATATGG + Intergenic
944092596 2:195929666-195929688 AAGTTTCATTCTTCTTCATATGG - Intronic
944675416 2:202031713-202031735 AAATTTCATGCTTATTCATCAGG - Intergenic
947099368 2:226603317-226603339 AATTTTAATGCTAATCCATAAGG + Intergenic
947270583 2:228329572-228329594 AATTTTCAGGCTTGTTCTTAAGG + Intergenic
1170201754 20:13751583-13751605 AAGTTTCAGGTTAATTGATCTGG - Intronic
1170642774 20:18170399-18170421 TAGATTCAGGATAATTTATAAGG - Intronic
1173584521 20:44172226-44172248 CAGTTTCAGGCAAATTGAGATGG + Intronic
1177434813 21:21037626-21037648 AATTTTCAGCCTAATTGTTAAGG + Intronic
1177967158 21:27742085-27742107 AAGTTTCATTCTACTGCATATGG + Intergenic
1180426299 22:15191523-15191545 AAGTTTCTAGCTAATTTTTATGG + Intergenic
1181916329 22:26283587-26283609 AGTTTTCAGGATAATTCCTATGG + Intronic
949633452 3:5955439-5955461 AAGTTTCAATCTTATGCATATGG + Intergenic
953799137 3:46008457-46008479 AAGTTTCAGGATAATTTGTTAGG + Intergenic
955255099 3:57323197-57323219 AAGTTTCAAGCTATTTCACTGGG - Intronic
957138660 3:76323694-76323716 AAGTTTCAAGCTGTTTCATTTGG + Intronic
958085615 3:88802466-88802488 CAGTTTCAGTCTTCTTCATATGG + Intergenic
958616319 3:96497334-96497356 ATGTTTCAGGCTTAATGATATGG - Intergenic
959140622 3:102482235-102482257 AAGTTTGAGGAGAATTCCTATGG - Intergenic
959551224 3:107660848-107660870 CAATTTCAGGGTACTTCATAGGG - Intronic
959651926 3:108758493-108758515 AAATTTGAGGCTAACTCATTTGG - Intergenic
960584060 3:119304469-119304491 AAGTGTCAGGCAAATTCCTGTGG - Intronic
960707612 3:120495496-120495518 GAGTTTTCGGCTAATTCATTTGG - Intergenic
962402589 3:135073928-135073950 AAGATTCAGGCTTATTTATTTGG + Intronic
963137598 3:141921758-141921780 AAGTATCAGGATAGTTCATGTGG + Intronic
964603081 3:158524922-158524944 ACATTTCAAGCTAATTCTTATGG - Intronic
965889440 3:173492852-173492874 AATTTTCAGCCTAAAGCATAGGG - Intronic
966356283 3:179082725-179082747 AAGTTCCATGCTAAGTCAGAAGG - Intergenic
969404893 4:6984506-6984528 AATTTTTAAGCTAATTCAGATGG - Intronic
971008338 4:22401580-22401602 AATATTCAGGCTAGTACATAAGG + Intronic
971497865 4:27286994-27287016 AAGTTTCAGGGTAATGTGTATGG + Intergenic
971608135 4:28685194-28685216 AACATTCAGGCTATTTCATGGGG + Intergenic
976440457 4:85067252-85067274 AAGTTTCAAGCAAATTCTAAAGG - Intergenic
978173889 4:105706914-105706936 GGGTTTCAGGAAAATTCATATGG - Intronic
978590598 4:110320660-110320682 AAAGTTCAGACTAGTTCATACGG - Intergenic
980157178 4:129121737-129121759 CAGTTTCAGGTTACTGCATATGG + Intergenic
980792879 4:137642449-137642471 CAGTTTCAGGCTAATTGGGATGG - Intergenic
987159593 5:15127771-15127793 TAGTTTCAGTCTTCTTCATATGG + Intergenic
988753762 5:34222721-34222743 AATTTTCTGGTTAATTCAAAGGG + Intergenic
988988975 5:36650879-36650901 AAGCTACAGGATAAGTCATAAGG + Intronic
989826409 5:45862216-45862238 AAGTTTCAGGTGATTCCATAGGG + Intergenic
991741546 5:69683577-69683599 AATTTTCTGGTTAATTCAAAGGG + Intergenic
991756072 5:69870862-69870884 AATTTTCTGGTTAATTCAAAGGG - Intergenic
991793120 5:70263315-70263337 AATTTTCTGGTTAATTCAAAGGG + Intergenic
991821005 5:70559651-70559673 AATTTTCTGGTTAATTCAAAGGG + Intergenic
991835475 5:70746779-70746801 AATTTTCTGGTTAATTCAAAGGG - Intergenic
991885569 5:71263620-71263642 AATTTTCTGGTTAATTCAAAGGG + Intergenic
993180169 5:84542346-84542368 AATTCTCAGGCTAAGTCATAAGG - Intergenic
996646907 5:125827896-125827918 AAGTTTCAGTCTAAGTCTGAAGG + Intergenic
996777104 5:127144350-127144372 ATGTTTCACACTAATTCAGATGG + Intergenic
996985562 5:129558865-129558887 AAATTTGAGATTAATTCATATGG + Intronic
999689152 5:154130935-154130957 AAGTTTGAGTATATTTCATAAGG - Intronic
1000260598 5:159584902-159584924 AAGTTTCAGGCTTATACACTGGG - Intergenic
1002686303 5:181013445-181013467 CAGTTTCAGGCTTCTGCATATGG - Intergenic
1002933982 6:1656104-1656126 AAAATTCAGGCTAATACATTTGG - Intronic
1005551932 6:26929558-26929580 AATTTTCTGGTTAATTCAAAGGG + Intergenic
1007276963 6:40681027-40681049 AAGTTTCAGGGAAAATCTTAAGG + Intergenic
1008882617 6:56395756-56395778 AGGTTTCAGGCCAGTACATAAGG - Intergenic
1010308327 6:74350868-74350890 AAGTTTCATGCTATTTAAAATGG - Intergenic
1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG + Intronic
1012272754 6:97235243-97235265 AAGTTTCAGGTTTTTGCATAAGG + Intronic
1012872596 6:104689754-104689776 AAGTTTCAGGCTACATAATAAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014258570 6:119189187-119189209 AAGTTTCTGGCTAACTCAAATGG - Intronic
1016632753 6:146251055-146251077 AATTTTCAGGCTTACACATAAGG + Intronic
1018546039 6:164937111-164937133 AACTTTCAAGCTACTTCACATGG - Intergenic
1019784411 7:2965965-2965987 AAGTTTCTGGATGAGTCATATGG + Intronic
1020823346 7:12997946-12997968 TAGTTTCAGTTTAATGCATATGG + Intergenic
1021732983 7:23614915-23614937 TAGATTCAGCATAATTCATAAGG + Intronic
1022935241 7:35168791-35168813 AAGTTTCAGTCTTCTGCATATGG - Intergenic
1022992288 7:35720390-35720412 AAGCTTCAGGCCAGTTCAGAAGG + Intergenic
1026662967 7:72318095-72318117 AAATTTCACTCAAATTCATAAGG + Intronic
1029054029 7:97721268-97721290 AACATTCAGTCTAATGCATATGG + Intergenic
1029831195 7:103261567-103261589 AAGTTTCAGTCTTCTGCATATGG - Intergenic
1031826340 7:126570712-126570734 AAGTGTCATGGTAATTCCTATGG - Intronic
1032486651 7:132292711-132292733 AACTTATATGCTAATTCATAGGG + Intronic
1034860997 7:154594752-154594774 AAGTTTCGGACTAATGCATTTGG + Intronic
1042946633 8:74161433-74161455 AAGTTTCAGCTTTATACATACGG - Intergenic
1043840645 8:85099677-85099699 AAGTTTTAGGACAATTGATATGG + Intergenic
1044364781 8:91331251-91331273 AAGTTTCAGATAAATGCATATGG - Intronic
1045378368 8:101598671-101598693 AAGTACCAGGGTACTTCATATGG - Intronic
1047059452 8:121207897-121207919 AAGTTTGAGGCTGATTCTTTGGG + Intergenic
1048517444 8:135123768-135123790 AAATTTCAGGCAAAGTCCTAAGG - Intergenic
1051665840 9:19466152-19466174 AAGTTTCAGGGTCATTTATTAGG - Intergenic
1052946490 9:34172596-34172618 AAGTTGCAGAATAATGCATATGG - Intergenic
1053250440 9:36569895-36569917 TAGATTCAGCATAATTCATAAGG - Intergenic
1055829752 9:80364189-80364211 AAGTTTCAATCTTCTTCATATGG + Intergenic
1059519022 9:114922409-114922431 TATTTTCAAGCTAATTCATTGGG + Intronic
1059844340 9:118256070-118256092 AAGATTCAGTATAATTCTTAAGG - Intergenic
1061016209 9:127982034-127982056 AAGTTTCAGGCAACTACATCTGG + Intergenic
1186776984 X:12874642-12874664 AAGGTTCAGGATAATTCAGTTGG + Intronic
1188470880 X:30537835-30537857 CAGTTTCAGTCTTATGCATATGG - Intergenic
1188671316 X:32885294-32885316 AGGTTTCAGGCTGCTTCCTATGG + Intronic
1189401425 X:40672805-40672827 AGAATTCAGGCTAACTCATAAGG + Intronic
1190538618 X:51455041-51455063 AAGTTACAGGCAAAGACATAAGG + Intergenic
1193935935 X:87621823-87621845 AAGTTTCAGCCTTTTTCTTATGG + Intronic
1193985263 X:88233570-88233592 ATGTTTAAGGCTAAATAATATGG - Intergenic
1194939912 X:99997230-99997252 TGGTCTCAGGCTTATTCATATGG + Intergenic
1197831194 X:130645446-130645468 AAGTTTCAGGCTTATGACTATGG + Intronic
1198252937 X:134899285-134899307 AACTTTAAGGCAAACTCATAGGG + Exonic
1198940715 X:141952654-141952676 AGGTTCCAGGCTGATTCCTATGG - Intergenic
1202350186 Y:23981509-23981531 CAGTTTCAGGCTTCTACATATGG + Intergenic
1202520593 Y:25688612-25688634 CAGTTTCAGGCTTCTACATATGG - Intergenic