ID: 1070269424

View in Genome Browser
Species Human (GRCh38)
Location 10:74938402-74938424
Sequence CCTGGTTCACATGATACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070269424_1070269426 -6 Left 1070269424 10:74938402-74938424 CCAGCAGTATCATGTGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1070269426 10:74938419-74938441 ACCAGGCCCTCAAAGTAGATAGG No data
1070269424_1070269432 6 Left 1070269424 10:74938402-74938424 CCAGCAGTATCATGTGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1070269432 10:74938431-74938453 AAGTAGATAGGGCAGGTAATTGG No data
1070269424_1070269428 -5 Left 1070269424 10:74938402-74938424 CCAGCAGTATCATGTGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1070269428 10:74938420-74938442 CCAGGCCCTCAAAGTAGATAGGG No data
1070269424_1070269433 27 Left 1070269424 10:74938402-74938424 CCAGCAGTATCATGTGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1070269433 10:74938452-74938474 GGAAAGAAGAGAAGATGAAGTGG No data
1070269424_1070269429 -1 Left 1070269424 10:74938402-74938424 CCAGCAGTATCATGTGAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1070269429 10:74938424-74938446 GCCCTCAAAGTAGATAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070269424 Original CRISPR CCTGGTTCACATGATACTGC TGG (reversed) Intronic
900672243 1:3861851-3861873 TCTGTTTAACATGGTACTGCAGG + Intronic
901171806 1:7264246-7264268 CCTGGTGCAGCTGATGCTGCTGG + Intronic
901364889 1:8738374-8738396 CCTGGTTCAAGTGATTCTCCTGG + Intronic
902182540 1:14700188-14700210 CCTCCTTCCCATGATATTGCTGG - Intronic
907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG + Intronic
910194512 1:84626159-84626181 CCTGGATCACAGGCTACTGATGG - Intergenic
911201332 1:95047434-95047456 CCTGGTTCAAGTGATTCTCCTGG + Intronic
912511544 1:110193470-110193492 CCTGGTTCCCAAGATGCTGTGGG - Intronic
913021453 1:114792205-114792227 CCAGGTTGACATCAGACTGCTGG + Intergenic
916602301 1:166304856-166304878 CCTGGCTCACAGGATTCTGTAGG + Intergenic
918315203 1:183317342-183317364 CCTGGCTCAAGTGATCCTGCTGG + Intronic
918947946 1:191094270-191094292 ACTGGCTCACATGATAATGAAGG - Intergenic
920937374 1:210448173-210448195 CCTGGTTCAAGTGATTCTCCTGG + Intronic
923978797 1:239296956-239296978 CCAGAATCACATGATTCTGCAGG + Intergenic
1063634531 10:7768921-7768943 CCAGGTTCAAATGATTCTCCTGG - Intronic
1063966704 10:11351771-11351793 CCTGCCTCACCTGATACTGTTGG + Intergenic
1067910225 10:50339036-50339058 CCTGGTTGAGATGCCACTGCAGG - Intronic
1070062250 10:72995480-72995502 GCTGGATCAAATGATACTTCTGG - Intergenic
1070269424 10:74938402-74938424 CCTGGTTCACATGATACTGCTGG - Intronic
1077731989 11:4741265-4741287 GCTGGGTCAAATGATATTGCTGG - Intronic
1081611546 11:44565979-44566001 CCTGGTTCACTTCCTCCTGCTGG - Intronic
1081825965 11:46052055-46052077 CCTGGGTCATATGCTACTCCTGG - Intronic
1081865917 11:46360690-46360712 CCGGGTTCAGATGATTCTCCTGG - Intronic
1083719387 11:64596832-64596854 CCTGGTTCTCATGCTGATGCAGG + Intronic
1084131841 11:67142130-67142152 CCAGGTTCAAATGATTCTCCTGG + Intronic
1088532088 11:110821354-110821376 ACTGGTTCACATGATTATGGAGG - Intergenic
1090880623 11:130828945-130828967 CCTGGTTCACATTTGGCTGCGGG + Intergenic
1096161571 12:49382796-49382818 CCTGGTTCAAGTGATTCTCCTGG + Intronic
1097942486 12:65326896-65326918 CCTGAGTGACATGGTACTGCAGG - Exonic
1100508834 12:95248276-95248298 ACTGTATCACATGATACTGTTGG + Intronic
1101877346 12:108604520-108604542 CGTGGTTCTCCTGATTCTGCAGG - Intergenic
1103211669 12:119171555-119171577 TCTGGTTCACATGCCACTGACGG + Intergenic
1103525112 12:121562388-121562410 CCAGGTTCAAATGATTCTCCTGG - Intronic
1104260431 12:127177199-127177221 CCTAGTCCACATGGTGCTGCTGG + Intergenic
1115197956 14:30822216-30822238 CCTGGTTCTCTTGATACAGAGGG - Intergenic
1115919625 14:38358106-38358128 ACTGGTTCACATGATTATGTAGG + Intergenic
1116409396 14:44603664-44603686 CTTGGTTCACATGATTATGGAGG - Intergenic
1116650817 14:47590216-47590238 TCTGGTTAACATTATACTGTAGG - Intronic
1118147422 14:63155751-63155773 CATGGTCCGCATGGTACTGCTGG - Intergenic
1119607380 14:76032391-76032413 ACTGGTTGGCATGCTACTGCAGG - Intronic
1119818359 14:77591652-77591674 CCAGGTTCAGATGATTCTGGGGG + Intronic
1120327527 14:83049925-83049947 CCTGGTTCACCTGATATTGAAGG - Intergenic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1124693507 15:31845120-31845142 TCTGGTTCCCATGTTACAGCTGG + Intronic
1126408823 15:48350876-48350898 CTGGGTTCACATGATTCTCCTGG + Intergenic
1128578373 15:68791551-68791573 CCTGGCTCAGATGACGCTGCAGG + Intronic
1129226011 15:74170897-74170919 CCTGGTTCACCTGGAACTGATGG - Intergenic
1129302972 15:74637014-74637036 ACTTGCCCACATGATACTGCTGG - Intronic
1131150965 15:90046959-90046981 CCTGCTTCTCAGCATACTGCTGG + Intronic
1131565867 15:93484908-93484930 CTTGTTTCACATGAGAGTGCTGG - Intergenic
1131840434 15:96430999-96431021 CCGGGTTCAAATGATTCTCCCGG + Intergenic
1132047240 15:98574719-98574741 CCTGGTTAACCTGACACTGCTGG - Intergenic
1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG + Intergenic
1144942263 17:18949976-18949998 CCTGGTTCTCATGAGTCTGAGGG + Intergenic
1145097403 17:20042483-20042505 CCAGGTTCCCCTGACACTGCTGG + Intronic
1145955509 17:28851779-28851801 CCTGGTTCAAGTGATTCTCCTGG - Intronic
1149806083 17:59619564-59619586 CCAGGTGCACGTGATACTGATGG - Intergenic
1150166419 17:62947944-62947966 CCTGGTTCACTTTCTTCTGCTGG + Intergenic
1150425150 17:65071477-65071499 CCAGGTTCAAATGATTCTTCTGG - Intergenic
1150556010 17:66254620-66254642 CCTGGTTCAAGTGATTCTCCTGG - Intronic
1151188366 17:72380001-72380023 CCTGGTACACCTGAAACTTCTGG - Intergenic
1152741509 17:82020440-82020462 CCTGGTGCTCATGATCCTGCAGG + Intronic
1154285288 18:13050143-13050165 CATGGTTCACTTGATACTTCTGG + Intronic
1154373004 18:13782492-13782514 CCTATTTAACATGGTACTGCAGG + Intergenic
1155240980 18:23863349-23863371 CCAGGTTCAAATGATTCTCCTGG - Intronic
1156178585 18:34576550-34576572 CCTGGTTCAAGTGATTCTCCTGG + Intronic
1159354561 18:67321093-67321115 GCTGGGTCAAATGGTACTGCTGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1165222435 19:34327911-34327933 CTTGGTTCACACTAGACTGCAGG - Intronic
925558503 2:5160872-5160894 CCTGGTTGACATGTCACTGGAGG + Intergenic
927959776 2:27233879-27233901 CCTGGTGCCTATGATTCTGCTGG - Intronic
930892333 2:56404866-56404888 CATGGTACACATCATACTACAGG + Intergenic
934168128 2:89315250-89315272 CCTGGTTCAAGTGATTCTCCTGG + Intergenic
934199157 2:89867331-89867353 CCTGGTTCAAGTGATTCTCCTGG - Intergenic
934538520 2:95156714-95156736 CCTGCTTAACATGTTACTGGTGG + Intronic
935753406 2:106258842-106258864 CCAGGTTCAAATGATTCTCCTGG + Intergenic
938478491 2:131636811-131636833 CATGGGTCATATGACACTGCAGG + Intergenic
941453249 2:165685448-165685470 CCTGGTTCCCATCATTCTACTGG - Exonic
943296581 2:186147925-186147947 CCTGGGTCAAATGATATTTCTGG - Intergenic
943664594 2:190595862-190595884 GCTGGTTCAAATGATATTTCTGG - Intergenic
945439256 2:209859559-209859581 CCTGGGTCAAATGATATTTCTGG + Intronic
945573060 2:211494811-211494833 CCTGGTTCACATGAGATGACTGG - Intronic
946482533 2:220071012-220071034 CCAGGTTCAAATGATTCTCCTGG + Intergenic
946752320 2:222904912-222904934 CCTGGGACACAGGATCCTGCTGG - Intronic
947392793 2:229656207-229656229 CCTGTTTCCCATGAGACTGCAGG - Intronic
947705371 2:232270759-232270781 CCTGATTCACATACTACTGAAGG - Intronic
948205243 2:236159886-236159908 CCTTGTTCTCCTGATACTCCCGG - Intergenic
948960123 2:241328336-241328358 CCTGGTTCAAGTGATACTCCTGG - Intronic
1174119890 20:48256890-48256912 CCTGGTTCACCTTCTTCTGCTGG + Intergenic
1175284648 20:57829972-57829994 GCTGGTTCACATGATTGTGGAGG - Intergenic
1177276551 21:18919599-18919621 GCTGGTTCAGATCATACTCCTGG + Intergenic
1182169082 22:28208431-28208453 CCTGGTTCTCTTGATTCTTCTGG - Intronic
1182647976 22:31825854-31825876 CCTCTTCCACATGGTACTGCAGG + Intronic
1185397291 22:50599635-50599657 CCGGGTTCAAATGATTCTCCTGG + Intronic
950206373 3:11084310-11084332 CCTGGTGCACAGGATAGTTCAGG + Intergenic
951795606 3:26534627-26534649 CCAGGTTCAAATGATTCTCCTGG + Intergenic
952198119 3:31097322-31097344 CCTGGTTTACATGATTGTGCTGG + Intergenic
955610410 3:60750775-60750797 CCTGGTTCACATGACAGGGAGGG - Intronic
957278820 3:78123815-78123837 CTTGGTTCACATGAGACTAATGG + Intergenic
961416721 3:126764580-126764602 CCAGGTTTACATGAGGCTGCCGG + Intronic
965868601 3:173238063-173238085 CCTGGTTCATGTGAGACTGAGGG - Intergenic
965873231 3:173285815-173285837 ACTGGGTCTCATGATATTGCTGG - Intergenic
966453678 3:180091450-180091472 CCGGGTTCAGATGATTCTCCTGG + Intergenic
967267325 3:187702117-187702139 GCTGGTACACATGGTCCTGCTGG + Exonic
969725302 4:8914970-8914992 CCTGCTTCCCATGAAGCTGCAGG - Intergenic
974406074 4:61472132-61472154 CATGGTTCATATGATGCTGTGGG + Intronic
975070828 4:70135400-70135422 CCTGGTTCAGGTGATTCTCCTGG - Intronic
975262739 4:72323025-72323047 CCTGGTGCGCATGATAATGCTGG - Exonic
976035368 4:80812279-80812301 CCTGCCTCCCATGAGACTGCAGG + Intronic
977676821 4:99757279-99757301 CCTGGTTCAAATGATTCTCCTGG + Intergenic
978813328 4:112875404-112875426 CCTGGTTCAAGTGATCCTCCTGG + Intronic
984268322 4:177520476-177520498 CCGGGTTCACATCATTCTCCTGG - Intergenic
985650059 5:1103290-1103312 CCTGGTTTACAGGATACTGGCGG - Intronic
987788195 5:22529254-22529276 GCTGGTTCAAATGATAATGGAGG + Intronic
988620847 5:32821929-32821951 CCTGGGTCACATGAGAATTCTGG - Intergenic
994825777 5:104711124-104711146 CCTGGTTCATGTGGTACTACTGG - Intergenic
995401271 5:111744660-111744682 TCTGCCTCACATGGTACTGCCGG - Intronic
996556718 5:124786032-124786054 CCTGGTTCAAGTGATTCTCCTGG + Intergenic
997590841 5:135071238-135071260 CCTGCTGCACCTGATATTGCTGG - Intronic
1000494469 5:161963413-161963435 ACTCGTTCAAATGATACAGCTGG + Intergenic
1001466269 5:171969172-171969194 CTGGGTTCACATGATTCTTCTGG - Intronic
1004656803 6:17670558-17670580 ACTGTTTAACATCATACTGCAGG - Intronic
1007353987 6:41297073-41297095 GCTGGTTCCCCTGATACTGGGGG - Intergenic
1007970657 6:46048808-46048830 CCTGACTGACATGACACTGCAGG - Intronic
1009754567 6:67920006-67920028 GCTGGGTCAAATGATACTTCTGG - Intergenic
1010866084 6:80978205-80978227 CCTGGTTCACTCAATACTGTGGG - Intergenic
1011334190 6:86242235-86242257 GCTGGTTCAAATGCTACTTCTGG - Intergenic
1012020169 6:93908107-93908129 GCTGGATCACATGATATTTCTGG + Intergenic
1012434330 6:99198939-99198961 GCTGGATCAAATGATACTTCTGG + Intergenic
1012450233 6:99347306-99347328 CCTGGTTCAAATGATTCTCCTGG - Intronic
1015857746 6:137643602-137643624 GCTGGGTCAAATGATACTTCTGG - Intergenic
1017026197 6:150183466-150183488 CCTGGTTAACATCTGACTGCGGG + Intronic
1018348365 6:162927265-162927287 GCTGGGTCAAATGATACTTCTGG - Intronic
1020981505 7:15075118-15075140 CCAGGTTCAAATGATTCTCCTGG - Intergenic
1029922943 7:104285680-104285702 CCTGGATCACTTGATTTTGCTGG - Intergenic
1033330742 7:140414959-140414981 CATGGTTCACAAGGTACTTCAGG + Intronic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034302116 7:150025329-150025351 CCTGGTACACATGCTAATGTTGG - Intergenic
1034803939 7:154071986-154072008 CCTGGTACACATGCTAATGTTGG + Intronic
1035217938 7:157383987-157384009 CCTGGTTCACATATTTCTTCAGG + Intronic
1035484613 7:159212968-159212990 CCTGGGTCACCTTATGCTGCTGG - Intergenic
1036149697 8:6286078-6286100 ACTGGCTCACATGATTCTGGAGG + Intergenic
1037408272 8:18566697-18566719 CTTGTCTTACATGATACTGCAGG + Intronic
1042543637 8:69931461-69931483 CCTGGTTCACCTTATTCTCCAGG - Intergenic
1042888808 8:73584168-73584190 CCTAGTTCATATGAAGCTGCTGG - Intronic
1043066368 8:75576130-75576152 CCTGGGTCAAATGGTACTTCTGG + Intergenic
1044103755 8:88175222-88175244 TCTGGGTCACATTATACTGTTGG + Intronic
1044162958 8:88943495-88943517 CCAGGTTCAAATGATTCTCCAGG - Intergenic
1044372263 8:91425772-91425794 CCTGGTTCACGTCATTCTCCTGG - Intergenic
1044822823 8:96168395-96168417 GATGGCTCACATGATACAGCTGG - Intergenic
1044989892 8:97786603-97786625 CCAGGTTCACGTGATTCTCCGGG - Intronic
1045344285 8:101280694-101280716 CCTGCTTTACCTGAGACTGCAGG + Intergenic
1048038543 8:130701806-130701828 CCTTGTTCCCATGGCACTGCTGG - Intergenic
1048184480 8:132227154-132227176 CCTGGTTCAACTGATTCTCCTGG + Intronic
1050002897 9:1097454-1097476 CCTGGGTGACATGATGCTGTTGG + Intergenic
1050883097 9:10728446-10728468 GCTGGTTCAAATGATATTTCTGG + Intergenic
1053462508 9:38281482-38281504 CCAGGTGCTCGTGATACTGCTGG - Intergenic
1053833258 9:42107057-42107079 CATGTATCGCATGATACTGCAGG - Intronic
1054597293 9:67080352-67080374 CATGTATCGCATGATACTGCAGG + Intergenic
1057098305 9:92332712-92332734 CCGGGTTCAAATGATTCTCCTGG - Intronic
1057509431 9:95665306-95665328 CCTGGGGCACAAGATACTTCTGG + Intergenic
1057964917 9:99493315-99493337 CATGATACACAGGATACTGCAGG - Intergenic
1058657973 9:107242043-107242065 CCTGGTTCAAGTGATTCTCCTGG - Intergenic
1058865645 9:109159892-109159914 ACTGGTTCACATGATTATGCAGG - Intronic
1061048978 9:128183017-128183039 CCTGGTGCAGATGATACATCTGG - Intronic
1190711933 X:53077727-53077749 CCTGCTTCACATGACACAGTAGG - Exonic
1190804480 X:53821796-53821818 CCAGGTTCAAGTGATTCTGCTGG - Intergenic
1191776416 X:64819388-64819410 CCTGGTTCAAATGATATTTCTGG - Intergenic
1193028100 X:76867098-76867120 CTTGGTTTACCTTATACTGCTGG - Intergenic
1194868693 X:99100757-99100779 CCTGGGTCAAATGATATTTCTGG - Intergenic
1195998028 X:110750829-110750851 CATTGTGCACATGTTACTGCAGG + Intronic
1199582884 X:149377941-149377963 CATGGTTCAGATGAGATTGCTGG - Intergenic
1201327176 Y:12774371-12774393 CCAGGTTCACATCATTCTCCTGG - Intronic