ID: 1070270298

View in Genome Browser
Species Human (GRCh38)
Location 10:74947661-74947683
Sequence AAGGGTAAACTGTAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070270298_1070270303 8 Left 1070270298 10:74947661-74947683 CCTTCTTCCTACAGTTTACCCTT 0: 1
1: 0
2: 1
3: 21
4: 343
Right 1070270303 10:74947692-74947714 TTCTACTGTTTACCCTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070270298 Original CRISPR AAGGGTAAACTGTAGGAAGA AGG (reversed) Intronic
901650048 1:10738056-10738078 AAGGGTAAACTCCACGAAGGAGG - Intronic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
904663984 1:32105986-32106008 AAAGGAAAACTCTAGGATGAAGG - Intergenic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906541000 1:46585980-46586002 AAGGAAAAAATGTAGGAAGATGG + Intronic
908880557 1:68727061-68727083 AAGGGCAAATTTTTGGAAGAAGG - Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
910489996 1:87757939-87757961 AAGGGTGAGCTGTCGGGAGAAGG + Intergenic
910889043 1:91998118-91998140 AAGGGTAAACTATAAGGATAAGG - Intronic
911380310 1:97106100-97106122 AAGGGTGGACTGTAGGATGATGG + Intronic
912725036 1:112051298-112051320 AAGGGGAAACTTTAAGAAGGCGG + Intergenic
912869106 1:113287596-113287618 GAAGGTACACTGCAGGAAGAAGG + Intergenic
914877111 1:151520331-151520353 AAGGGTAAAATCAGGGAAGATGG - Intronic
916439656 1:164810745-164810767 AGAGGTAAACTGGAGGAGGAAGG - Intronic
916829700 1:168477919-168477941 CAGGGCAAACTATAAGAAGATGG - Intergenic
917168186 1:172137789-172137811 AAGGGTAAAAGGTGGGAAGATGG - Intronic
917183726 1:172327960-172327982 AATAGTAAACTGTTGGGAGAAGG + Intronic
918352265 1:183669645-183669667 AGTGGTAAGGTGTAGGAAGAAGG + Intronic
918675346 1:187277916-187277938 AAGGATAAACTGTAATAAGCAGG + Intergenic
919103806 1:193124480-193124502 AAGGGGAAAGTGTAGAAGGAAGG + Intronic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919419853 1:197356006-197356028 AAGGTTAAACTGTAAGACAATGG + Intronic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
920552146 1:206871175-206871197 AAGGGAAAACTGCACAAAGATGG + Intergenic
921026379 1:211286913-211286935 AAGGATATACTGCAGGAAAAAGG - Intronic
921993453 1:221392117-221392139 AATGGTAAACTTTTAGAAGATGG + Intergenic
924819737 1:247477332-247477354 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
1063113655 10:3057688-3057710 AAGGGTCAACTGTTTGAACAGGG + Intergenic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1066272531 10:33837530-33837552 AAGGGGATAGTGTGGGAAGAAGG - Intergenic
1068330525 10:55560224-55560246 AAGGAAAAAATGCAGGAAGATGG + Intronic
1068465474 10:57384424-57384446 AAGTGGAAACTGTGGGCAGAAGG - Intergenic
1068647270 10:59481443-59481465 AAGGGAACACTGGCGGAAGAAGG + Intergenic
1069848328 10:71388611-71388633 AAGGGTATGCTTTAGGCAGAAGG - Intergenic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1071306433 10:84302970-84302992 AATGTTAAAATGGAGGAAGATGG - Intergenic
1071909812 10:90218763-90218785 AATGGTAGACTGGAGGAACATGG - Intergenic
1072755225 10:98016197-98016219 AAGGGCAGAGTCTAGGAAGAAGG + Intronic
1072838961 10:98748675-98748697 AAGGGCAAAATGTAGAAAGATGG + Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1075139194 10:119816302-119816324 AAGAGGAAAATGTAGGAAGAAGG - Intronic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075270000 10:121041297-121041319 AATGGTAAAATGAAGTAAGAGGG + Intergenic
1075347317 10:121692902-121692924 AAGGGCAAACTGCAAAAAGATGG + Intergenic
1076292172 10:129354125-129354147 TGGGGTAAACTGTAAGAGGAAGG + Intergenic
1078838038 11:15050824-15050846 AAGGATAAACTATATGAAAATGG + Intronic
1078844768 11:15111079-15111101 GAAGTTATACTGTAGGAAGATGG - Intergenic
1079321806 11:19457644-19457666 AAGGGTGAATTGTAGGGAGTGGG + Intronic
1079801338 11:24873503-24873525 AAGGGTTATCTGAAGGAAAAAGG - Intronic
1080170416 11:29295395-29295417 AAGTCTGAAATGTAGGAAGAAGG + Intergenic
1083848064 11:65347989-65348011 GAGGGTAGACTGTAGGGACAAGG + Intronic
1084433576 11:69124758-69124780 AAGGGTCAGCTGTAGACAGATGG + Intergenic
1085300680 11:75456566-75456588 AAGGGTTAAGTGAATGAAGACGG + Intronic
1085364354 11:75925470-75925492 AAGAATCAACTGTAGGAATAAGG - Intronic
1086314705 11:85579232-85579254 AAGGGTGAAGGGTAGGAGGAGGG + Intronic
1087358537 11:97126348-97126370 AGGGGTCAACTGTAGGAAAGAGG - Intergenic
1088178349 11:107080448-107080470 GAGGGTAAAGGGTGGGAAGAGGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1090961965 11:131565173-131565195 AAGGGTCAGCTGCAGGAAGGGGG - Intronic
1092126176 12:6076665-6076687 AAGGGTAAACTGGAGCCAGTTGG + Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1094365809 12:29679743-29679765 AAGGGTAACCTATAAGTAGAGGG + Intronic
1097114610 12:56688212-56688234 AAGAGGAAAGTGTAGGAAAAGGG + Exonic
1098478202 12:70930202-70930224 ATGGGGAAACGGTAGGAAGGAGG - Intergenic
1099201794 12:79686893-79686915 AAGGCTATAATCTAGGAAGAAGG - Intronic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1100571290 12:95845403-95845425 AAGGGTTAAATGGAGGAAGGAGG - Intergenic
1100786016 12:98079553-98079575 AAAGGTAAACTGTCAAAAGAAGG - Intergenic
1100936251 12:99670543-99670565 AAGGCTGAACTCTAGGATGAGGG + Intronic
1101396858 12:104356205-104356227 GTGGGGAAACTATAGGAAGATGG + Intergenic
1101677978 12:106937084-106937106 AAGGGGAAACAGTAGAGAGAAGG - Intergenic
1102304398 12:111793468-111793490 AAGGGGAAACTGGTGGAACAGGG - Intronic
1102486748 12:113263681-113263703 ACAGGTAAAATGTGGGAAGAGGG - Intronic
1104524608 12:129507703-129507725 AAGGGGAAAGGGTAGGAAGGGGG + Intronic
1104619199 12:130298119-130298141 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
1105465191 13:20633393-20633415 AAGGGTCACCTCTAGGAAGGGGG + Intronic
1105926256 13:25011489-25011511 AAAGTTAAAGCGTAGGAAGAAGG + Intergenic
1106027048 13:25965247-25965269 ATGGGGAAAATGTAGAAAGATGG - Intronic
1106616490 13:31334673-31334695 AAGGGTAACCTGTAGGCAACAGG + Intergenic
1106973806 13:35180818-35180840 AAGGGAAAAGTGTGGGAAGTGGG - Intronic
1107749475 13:43548963-43548985 AAGGAGAGACTCTAGGAAGAGGG - Intronic
1107960832 13:45556545-45556567 AAGGGGAAAGGGTAGGAAGGGGG - Intronic
1109100408 13:58177245-58177267 AAGTGGAAACTGTAGAAAAAAGG - Intergenic
1110015581 13:70397135-70397157 AAGGGCAAACTGGAGGCAAATGG - Intergenic
1110110612 13:71740904-71740926 AAGGCTAAAAGGTAGGTAGATGG - Intronic
1110634819 13:77754584-77754606 AGGAGTAAACTGAACGAAGAAGG - Intronic
1111124741 13:83899766-83899788 AAGGAAAAACTATAGGAAGTCGG + Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1113281105 13:108788848-108788870 GAAGGAAAACTGTGGGAAGATGG - Intronic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1115014162 14:28589624-28589646 AATGCTAAACTGAAGAAAGATGG - Intergenic
1115518286 14:34207174-34207196 AAGGGTAAAACGTAGGAACTGGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1116260367 14:42616945-42616967 AAGGAAAAAGTGTGGGAAGAGGG - Intergenic
1116387043 14:44344557-44344579 AAGTGTACAATGTGGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1118412157 14:65492266-65492288 TAGGCTAAACTGAAGTAAGAAGG - Intronic
1119004774 14:70914059-70914081 AAGGGTACACTGTCCAAAGATGG + Intronic
1120096876 14:80399238-80399260 AAGGGGACACTACAGGAAGATGG - Intergenic
1120123464 14:80712187-80712209 GATGGTAAACTGTAAGAAAAAGG + Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121302431 14:92882005-92882027 AAGGATAAACTACAGGAACAGGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124653281 15:31488154-31488176 AAGGGTAAACACCAGGCAGAAGG + Intronic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124924868 15:34061202-34061224 AAGGGTAAATTGTAGAAATTAGG - Intronic
1124963784 15:34418542-34418564 AAGGCTAAATTATAGGAAGAAGG + Intronic
1124980404 15:34564773-34564795 AAGGCTAAATTATAGGAAGAAGG + Intronic
1125380830 15:39084740-39084762 AATAGTAAACTGTAGGACAATGG - Intergenic
1125634147 15:41173067-41173089 AAGGGGAAAGTGGGGGAAGAAGG - Intergenic
1126047259 15:44653810-44653832 AAGGGTCAACTGTATGTATAGGG - Intronic
1127161949 15:56197800-56197822 AGGGGTGGACTGCAGGAAGATGG + Intronic
1127799580 15:62466322-62466344 AAGCCTAAAATGTAGGAAGCAGG - Intronic
1128698172 15:69784450-69784472 AGGGGGAAAGAGTAGGAAGAGGG - Intergenic
1129556066 15:76511097-76511119 AGGGGGAAAGGGTAGGAAGAGGG + Intronic
1131690670 15:94824194-94824216 AAGGGTCAGCTGTATGGAGAGGG + Intergenic
1131820581 15:96269391-96269413 AAGGGTACACTGTAGTCAGGTGG - Intergenic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1134818231 16:17223810-17223832 ATGGGTAAACTGTAGCCAGTGGG - Intronic
1135875394 16:26195320-26195342 AAGGGCAAATTTCAGGAAGAAGG + Intergenic
1135895393 16:26396431-26396453 AAGGGTGAGCTGTGGAAAGAAGG - Intergenic
1136580248 16:31147263-31147285 GAGGGTACATTGCAGGAAGATGG - Intronic
1137969330 16:52968417-52968439 GAGGGTAGAGTGTGGGAAGAGGG - Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138921754 16:61538896-61538918 GAGGGTAAAATGTGAGAAGAGGG + Intergenic
1139002737 16:62533105-62533127 AAGAGTAATCTCTAGGAAAACGG + Intergenic
1139754393 16:69131728-69131750 AAGAGTAATCTTTGGGAAGAGGG - Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1142632094 17:1231692-1231714 AAGGCTAAATTATAGGAAGAAGG - Intergenic
1144402636 17:14920985-14921007 ATTGGTAAATTGAAGGAAGATGG + Intergenic
1144506231 17:15833706-15833728 AGGGGTAATTTATAGGAAGATGG - Intergenic
1144712271 17:17409629-17409651 AAGAGTACCCTGGAGGAAGAAGG - Intergenic
1145170407 17:20651639-20651661 AGGGGTAATTTATAGGAAGATGG - Intergenic
1146817666 17:35956135-35956157 AAGGGTGGAGAGTAGGAAGAGGG - Intergenic
1150927354 17:69546932-69546954 CAGAGTAAAATCTAGGAAGAAGG + Intergenic
1154282526 18:13017559-13017581 ATTGGTTAACTGGAGGAAGAGGG - Intronic
1156280739 18:35635115-35635137 AAGGATACAATGCAGGAAGAAGG + Intronic
1156354843 18:36332061-36332083 AAGGGAACACTGCAGGAGGAAGG - Intronic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156830401 18:41484572-41484594 AAGGGTCAGATTTAGGAAGAGGG + Intergenic
1159447394 18:68557537-68557559 AAGGGGATGGTGTAGGAAGAAGG + Intergenic
1160248055 18:77176250-77176272 AAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1160607142 18:80059672-80059694 AAGGGTGTCCTGCAGGAAGAGGG + Intronic
1161612288 19:5250204-5250226 AAGGGTGTGCTCTAGGAAGAGGG + Intronic
1163712875 19:18857306-18857328 AAGGATCAGCTGTAGGAACAGGG - Exonic
1163779934 19:19240735-19240757 AAGGGTAAACTGAGGCCAGATGG - Intronic
1165616184 19:37203278-37203300 AAAGCTAAACTGTAGATAGAGGG - Intronic
1165969698 19:39616723-39616745 AAGGAGAAAGTGTGGGAAGAAGG - Intergenic
1166562720 19:43744023-43744045 AAGGGAAAAATGTAGGAATTTGG - Intronic
1168578168 19:57531056-57531078 CATGGGAATCTGTAGGAAGAGGG - Exonic
1168592896 19:57651775-57651797 AAGGGAAAGTGGTAGGAAGACGG - Intergenic
926842276 2:17094342-17094364 AATGGTTGACTGTGGGAAGAGGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927767242 2:25822237-25822259 AAGAGAAAAGTGTAGGAAAAGGG - Intronic
929963858 2:46519042-46519064 AAGGGTCATCTGTACAAAGAAGG - Exonic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
930733929 2:54755973-54755995 AAGGGGAAATTGTATGCAGAGGG + Intronic
934578671 2:95420405-95420427 AATGGGAGACTGGAGGAAGATGG - Intergenic
934600771 2:95656304-95656326 AATGGAAGACTGGAGGAAGATGG + Intergenic
935792651 2:106607929-106607951 AATCTTAGACTGTAGGAAGAGGG + Intergenic
935876152 2:107510468-107510490 AAGAGTAAACTGCATAAAGAAGG + Intergenic
936534146 2:113298442-113298464 AATGGGAGACTGGAGGAAGATGG + Intergenic
938267780 2:129941071-129941093 TAGGATAAGCTGTAGGAAGATGG + Intergenic
940686164 2:156853678-156853700 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941762987 2:169265110-169265132 AAGGGGAAGATGTGGGAAGATGG - Intronic
942647659 2:178131410-178131432 AGGGGAAAACTGTAGGAAATAGG - Intronic
943644642 2:190396750-190396772 AAAGGCAAACTATAGGAACAGGG + Intergenic
944500399 2:200353538-200353560 AATGGTAAAGGGTTGGAAGAGGG - Intronic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
945372109 2:209031893-209031915 AAGAGTACAGTGTAGAAAGAAGG + Intergenic
945677669 2:212875700-212875722 AAGAATAGACTGTAGGAAGAAGG + Intergenic
945771053 2:214043277-214043299 AAGGGTAAACTATAGAAACCAGG - Intronic
948110066 2:235447843-235447865 AAGATTAAACTGTTGGAAGATGG + Intergenic
948503870 2:238414942-238414964 AAGGATCAACTTTAGAAAGATGG - Intergenic
1170710807 20:18788829-18788851 AAGGGTTCCCTGTAGCAAGAGGG + Intergenic
1171029318 20:21663087-21663109 AAGGTAAGACTGCAGGAAGAAGG + Intergenic
1173155800 20:40607605-40607627 AAGGGGAAAGTCTAGAAAGAAGG - Intergenic
1173674776 20:44824186-44824208 AAGGGCAAGCTGAAGGCAGATGG - Intergenic
1173863378 20:46298551-46298573 AGGGGTGAACTGCAGGCAGATGG + Intronic
1177021263 21:15861149-15861171 ATGGGTCATCTGTAGGTAGATGG + Intronic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177507366 21:22036192-22036214 GAGGGTGAAGGGTAGGAAGAGGG - Intergenic
1177820744 21:26028538-26028560 AAGGGTAAACTGCAGAGACACGG + Intronic
1178440296 21:32593074-32593096 AAGGGTATCCTCTGGGAAGAAGG - Intronic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1182189869 22:28447710-28447732 AACAGTAAACTGTATCAAGAAGG + Intronic
1183726632 22:39593523-39593545 AAAGGGAAAGTGTAGGCAGAAGG + Intronic
1185114869 22:48926931-48926953 TCTGGTACACTGTAGGAAGATGG - Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
950861773 3:16154061-16154083 AAGGCTATAGTGCAGGAAGAAGG + Intergenic
951571669 3:24070488-24070510 AAGGGTAGAGGGTAGGAGGAGGG - Intergenic
951941420 3:28082982-28083004 ATGCGTAAACTGTAGGTACAGGG - Intergenic
951958900 3:28292406-28292428 AAGGGTAAAATCAGGGAAGAAGG - Intronic
952388274 3:32858953-32858975 AAGGGTAAACTTCACAAAGATGG - Intronic
953578950 3:44136135-44136157 AAGGGTAAAGGGGAGGAAGCAGG - Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
955100641 3:55846138-55846160 GAAGGTAAAGTGTAGGATGAGGG - Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955825634 3:62944178-62944200 AAGGATAAATCGTAGGCAGATGG - Intergenic
956988021 3:74726544-74726566 AGGTGTAAACTGTCGGAAGGAGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958057965 3:88438352-88438374 AAAGGTAAACAGGAGAAAGAAGG - Intergenic
958476208 3:94586321-94586343 AAGGGTACACTGGAGGAGAATGG - Intergenic
962047732 3:131778290-131778312 AAGGGTACACGATAGGAGGAGGG - Intronic
963208029 3:142656374-142656396 AAGGGTAAAATATATGAAAATGG - Intronic
963475614 3:145799885-145799907 AAGGGTAAACACTTGGAAGGAGG - Intergenic
965008931 3:163060620-163060642 AAGGCTAAACTCTTGGGAGAAGG - Intergenic
965645361 3:170874582-170874604 AAAGATATACTTTAGGAAGAAGG + Intergenic
966763748 3:183439892-183439914 GAGGGTGAACTGTGGGAAAAGGG + Intergenic
967069215 3:185947343-185947365 ATGGGGAAACTTGAGGAAGAAGG + Intergenic
969355462 4:6622748-6622770 AAGAGTAAACTGTAAGATGTAGG + Exonic
971162189 4:24144689-24144711 AAGGGGAAAGTGGAGGGAGAAGG - Intergenic
971430938 4:26566603-26566625 CAGGGAAGAATGTAGGAAGAAGG - Intergenic
972268774 4:37488852-37488874 AAGGGTCAACTGGAGGACTAAGG - Intronic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973723165 4:53745800-53745822 TAAGGAAAACTGTATGAAGATGG - Intronic
974782299 4:66568767-66568789 AAGGGCCAACTGTAAAAAGAAGG - Intergenic
974825133 4:67118688-67118710 AAGGGTAGAGGGTGGGAAGAGGG - Intergenic
974927363 4:68316796-68316818 AAGGGAAAACTGAAGCAACAAGG + Intronic
974938388 4:68434603-68434625 AAGGGTAAACTATATGCTGAAGG + Intergenic
975963899 4:79945937-79945959 AATGGTAAAATGTAAGATGAAGG + Intronic
976980125 4:91217173-91217195 AAGAGTAAGCAGTAGCAAGAGGG + Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979370513 4:119880460-119880482 GAGGGTGAAGTGTAGGAAGAGGG + Intergenic
979542227 4:121898120-121898142 AGAGGTAAAATGTAGGACGAAGG + Intronic
979602500 4:122601873-122601895 AATGATAAACTTTTGGAAGAAGG + Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982500089 4:156143400-156143422 AATAAGAAACTGTAGGAAGAGGG + Intergenic
983431019 4:167651590-167651612 AAGGATATACTGGTGGAAGAAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986374541 5:7116644-7116666 AAGGGTGGAGGGTAGGAAGAGGG - Intergenic
986568378 5:9138751-9138773 AGGGGCAAAGTGTAGGAAGGGGG - Intronic
986757303 5:10850099-10850121 GAGGGTATACTTGAGGAAGATGG + Intergenic
987619677 5:20324687-20324709 GAGGGTAAAATGTAGTAAGAAGG + Intronic
989176210 5:38529075-38529097 AAGGGTAAACTGATGAAAGTGGG + Intronic
989504518 5:42211719-42211741 GAGGGTGAAGGGTAGGAAGAAGG - Intergenic
989735733 5:44702561-44702583 AAGGGCATACTGTAGGAGTAAGG + Intergenic
990443528 5:55870549-55870571 AAGGGAAAGATGGAGGAAGAGGG - Intronic
990820977 5:59840031-59840053 AGGGGGAAAGTGTTGGAAGATGG - Intronic
991592615 5:68269390-68269412 AAATGTAAACTGTTGGAGGATGG + Intronic
992868530 5:80982429-80982451 ATGTTTAACCTGTAGGAAGAAGG + Intronic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
995432590 5:112098053-112098075 AAAGGAAAACGGTAGGAAAAGGG + Intergenic
995448674 5:112276031-112276053 AATGGCAAACTCTGGGAAGAAGG + Intronic
995992893 5:118264106-118264128 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
996491142 5:124098929-124098951 AGAGGTAAGCTGAAGGAAGAAGG + Intergenic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
998861878 5:146452165-146452187 AAGGGTAATCTATAAGCAGAGGG + Intronic
999796129 5:154991358-154991380 AAGTGTAAACTCTAGGAAGAGGG + Intergenic
999863948 5:155679939-155679961 AAGGGAATAGTGCAGGAAGAAGG - Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001190956 5:169630762-169630784 AAGGGGAAATGGTGGGAAGAGGG - Intergenic
1002982856 6:2159184-2159206 AAGGGTCAACTATACGTAGAAGG - Intronic
1003473691 6:6461694-6461716 AAGGGAAAAGTGTGGGCAGAGGG + Intergenic
1003922169 6:10843033-10843055 AAGGCTATACTTTAGGATGAAGG - Intronic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008764011 6:54888388-54888410 AAGGGAATTCTTTAGGAAGAAGG - Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1011638180 6:89394801-89394823 AATGGCAAAGTGTAGGTAGAAGG + Intronic
1011859447 6:91736978-91737000 AAAGGTCACCTGTATGAAGAAGG + Intergenic
1012143771 6:95656003-95656025 AAGGCCAAAAAGTAGGAAGAAGG + Intergenic
1013815001 6:114087150-114087172 AAGGGTGAATTGGAGGAAGAGGG - Intronic
1015189167 6:130454639-130454661 GAGGATACACTGTAAGAAGATGG + Intergenic
1016599196 6:145837797-145837819 AAGGGTGATCTGTAGGGAGCCGG - Intergenic
1017604789 6:156122439-156122461 AAGGATAAACTATAGGATGATGG - Intergenic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017702103 6:157084401-157084423 AAGGGCAAACTGTATGGGGATGG + Intronic
1017791184 6:157801052-157801074 AAAGGTAGACTGTCGGAAGTGGG - Intronic
1017831304 6:158132534-158132556 AAGGGTACAAGGTGGGAAGAGGG - Intronic
1021264942 7:18508573-18508595 AAGGGTGAACCTTAGGAACAAGG - Intronic
1021800496 7:24301031-24301053 AAGGATATACTCCAGGAAGAAGG - Intergenic
1022291298 7:29006249-29006271 GAGGGTAAACTGAAGAGAGAGGG - Intronic
1022564342 7:31382566-31382588 AAGGCTGAACTTTAGAAAGAAGG + Intergenic
1022957954 7:35398712-35398734 CAAGGTAAACGGTGGGAAGAAGG - Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023409157 7:39871506-39871528 AAGGGCAAACTGGTGGATGATGG - Intergenic
1023815002 7:43942995-43943017 ACGGGTAATCTGTAGGAAAGTGG - Exonic
1023909605 7:44543984-44544006 AAGGTGAGACTGTGGGAAGATGG - Intergenic
1024237856 7:47411600-47411622 AAAAGTACCCTGTAGGAAGAAGG - Intronic
1024473322 7:49785869-49785891 AAGGATGAAATTTAGGAAGAAGG + Intronic
1025043773 7:55672529-55672551 AAGGGCAAACTGGTGGATGATGG + Intergenic
1025136699 7:56421044-56421066 AAGGGCAAACTGACGGATGATGG + Intergenic
1025473696 7:60892644-60892666 AAGGGTAAACTAAAATAAGAAGG + Intergenic
1025489073 7:61089036-61089058 AAGGGTAAACTAAAATAAGAAGG - Intergenic
1025513309 7:61597222-61597244 AAGGGTAAACTAAAATAAGAAGG - Intergenic
1026107315 7:67431457-67431479 AAGGGTGAACTGTAACAATATGG + Intergenic
1026408197 7:70090650-70090672 AAGGATAACCTTTAGGAAGAGGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029300636 7:99580139-99580161 AAGGGAGGACTGCAGGAAGATGG - Intronic
1029622950 7:101701402-101701424 AAGGCTACACTCTAGGAAAATGG + Intergenic
1030664625 7:112262145-112262167 AAGGGCAGATTGTAGGAAGGAGG - Intronic
1031010436 7:116521038-116521060 AATGGGCAACTGTAGGAAGGAGG + Intergenic
1031071967 7:117171770-117171792 AAGGAAACACTTTAGGAAGATGG - Intronic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031770502 7:125835101-125835123 AAGGGTGCACTTTAGGAACAAGG - Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1032813010 7:135441976-135441998 AATGGTAAAAGGTAGGAGGAGGG + Intronic
1034010959 7:147529099-147529121 AAGGGTATAATGTAGATAGATGG - Intronic
1034151956 7:148924059-148924081 CATGGTAACCTATAGGAAGAAGG - Intergenic
1036137276 8:6173864-6173886 AAGGGCAAACTGGAGGTAGAAGG - Intergenic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1037515842 8:19630882-19630904 AGGGGGAAACTGTAGGGAGGCGG - Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038027483 8:23605052-23605074 AGGGGGAAATGGTAGGAAGAGGG + Intergenic
1039253596 8:35693700-35693722 AATGGGAAAATGTAGGTAGAAGG - Intronic
1039335004 8:36579111-36579133 GAGGGTAAAGGGCAGGAAGAGGG + Intergenic
1040045130 8:42955114-42955136 AAGGGTCAACTGTATTGAGAGGG - Intronic
1040112726 8:43576990-43577012 AAGGATAAAAAGTAGAAAGAAGG + Intergenic
1041608436 8:59814116-59814138 AAGGGTATACTTGAAGAAGATGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1044931693 8:97258017-97258039 ATGTGTAAACTGTAGGGGGAGGG - Intergenic
1047128582 8:121991273-121991295 AAGGTTAAACTTAAGGGAGATGG + Intergenic
1047136764 8:122088001-122088023 AGGGGTAAAATTTAGGAGGAGGG + Intergenic
1048407552 8:134138728-134138750 AATGGGAAACTGAAGGAAGGAGG - Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1050859443 9:10407923-10407945 ATGGGGAAACTTTTGGAAGAAGG + Intronic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1051735615 9:20196218-20196240 TAAGGTAAACTGTAAAAAGATGG - Intergenic
1051930501 9:22379672-22379694 TTGGGAAAACTGTAAGAAGAAGG + Intergenic
1052440595 9:28491922-28491944 AAAGGGAAACTGTGGGAAAAAGG + Intronic
1054896186 9:70314118-70314140 GAGGGTAAATTCTTGGAAGAAGG - Intronic
1055118240 9:72628226-72628248 AAGGGAAAACTGTAGCATGTGGG + Intronic
1055625504 9:78173363-78173385 AAGGCTATAATTTAGGAAGATGG - Intergenic
1057939726 9:99271455-99271477 AAGGATTATCTTTAGGAAGAAGG - Intergenic
1059029016 9:110669101-110669123 AAGGGTGAAATGTATGATGAGGG + Intronic
1059519577 9:114927914-114927936 AAGGGTTTCCTATAGGAAGATGG - Intronic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1059783539 9:117555145-117555167 AAGGGTGAACTGAAGTAAAAAGG + Intergenic
1059812026 9:117865957-117865979 AAGGGTAAAGGGGAGGAAGCAGG + Intergenic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1060675433 9:125510167-125510189 AAAGGTAAAAAGTAGGAAGGGGG + Intronic
1062246950 9:135574027-135574049 AAAGGCCAACTGGAGGAAGATGG + Intergenic
1186182651 X:6988058-6988080 AAGGATACAATGCAGGAAGAGGG + Intergenic
1186320474 X:8418678-8418700 AAGGCTAAGCTGTTGGAATAGGG - Intergenic
1187076983 X:15945202-15945224 AAGGTAAAATTGTAAGAAGATGG - Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1188959727 X:36476195-36476217 GAGGGTAGACAATAGGAAGAAGG + Intergenic
1190493400 X:51004689-51004711 AAAGGGACACTGGAGGAAGAAGG - Intergenic
1190819812 X:53962931-53962953 AAGGATAGACTGCAGGGAGAAGG + Exonic
1192083526 X:68071356-68071378 AAGGGAAAACTCTGGGAACAAGG - Intronic
1192336275 X:70222811-70222833 AATGGTTATCTGTAGGGAGAGGG - Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193959773 X:87910933-87910955 AAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1194551239 X:95302117-95302139 AAGGGTGGACGGTAGGAGGAGGG + Intergenic
1195670678 X:107467222-107467244 ACAGATAAGCTGTAGGAAGATGG + Intergenic
1195964091 X:110414396-110414418 AAGGGTGAAGTGGAGGAAAAAGG + Intronic
1197166300 X:123381340-123381362 AAGGGTCAGTGGTAGGAAGATGG - Intronic
1197505062 X:127291501-127291523 AAGGGGAAAATGTAGGCACAGGG + Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1199570994 X:149267085-149267107 AAGGGTCAACTGTGGGGAAATGG - Intergenic
1201772211 Y:17625810-17625832 AAGGGACAACTGCAGGGAGAAGG + Intergenic
1201829344 Y:18280176-18280198 AAGGGACAACTGCAGGGAGAAGG - Intergenic