ID: 1070271016

View in Genome Browser
Species Human (GRCh38)
Location 10:74955024-74955046
Sequence CAGTGGTGGTAGAGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070271016_1070271022 -7 Left 1070271016 10:74955024-74955046 CCCTCACCCCTCTACCACCACTG No data
Right 1070271022 10:74955040-74955062 ACCACTGATACCAAATTCCATGG No data
1070271016_1070271026 19 Left 1070271016 10:74955024-74955046 CCCTCACCCCTCTACCACCACTG No data
Right 1070271026 10:74955066-74955088 CTCAAGTCCCTTATGTAAAATGG 0: 32
1: 254
2: 794
3: 1058
4: 1110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070271016 Original CRISPR CAGTGGTGGTAGAGGGGTGA GGG (reversed) Intronic
No off target data available for this crispr