ID: 1070274612

View in Genome Browser
Species Human (GRCh38)
Location 10:74993671-74993693
Sequence GTACTATTCCAGATTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070274612 Original CRISPR GTACTATTCCAGATTAAAGG AGG (reversed) Intronic
900963675 1:5942611-5942633 GAACTGTTCCAGAATTAAGGAGG + Intronic
904772770 1:32889805-32889827 GAGCTATTCCAGATTAAAGGGGG - Intronic
904954386 1:34270883-34270905 GTATTATGCCAGAGTGAAGGTGG + Intergenic
905505233 1:38474178-38474200 GTCATATTTCAGCTTAAAGGTGG - Intergenic
909577371 1:77189443-77189465 GTACTAACCCAGGTTAAAGGTGG - Intronic
909967221 1:81929634-81929656 GTACAATTCAAGATTAGAGTTGG + Intronic
911068583 1:93813890-93813912 GAACTGTTCCAGGTTAAAGGAGG - Intronic
911132397 1:94402716-94402738 GAAATGTTCCAGATTAAAGGAGG - Intergenic
911549105 1:99258154-99258176 GCAATAATCCAGATTCAAGGTGG - Intergenic
912087501 1:106027849-106027871 GAGCTATTCCAGATCAAAAGAGG + Intergenic
912114423 1:106387513-106387535 GTAATAATCCACATTAATGGTGG - Intergenic
912823499 1:112885711-112885733 TTACTATTCCACATAACAGGTGG + Intergenic
917231153 1:172839632-172839654 TTATTATGACAGATTAAAGGTGG + Intergenic
918774083 1:188607006-188607028 GTGCTCACCCAGATTAAAGGTGG - Intergenic
918899161 1:190390288-190390310 TTAAATTTCCAGATTAAAGGTGG + Intronic
920116586 1:203626086-203626108 GTACCTTTCAAGATTAAATGAGG + Intergenic
920442637 1:205991172-205991194 TTACTATCCCAGATAAGAGGAGG + Intronic
921061640 1:211590219-211590241 GAAATGTTCCAGATTAAAGGAGG - Intergenic
921940812 1:220837481-220837503 AAACTGTTCCAAATTAAAGGAGG + Intergenic
922139024 1:222862917-222862939 GTACTGTTCCAGATTAAAGAAGG - Intergenic
923567645 1:235088424-235088446 GGACTACTGGAGATTAAAGGTGG - Intergenic
924730257 1:246704582-246704604 TTACTCTTCCAGATTCCAGGAGG + Intergenic
1063408656 10:5819614-5819636 GTACTGTGGCAGATTAAAGATGG - Intronic
1065981129 10:30898489-30898511 GTATTATACCCAATTAAAGGTGG - Intronic
1066567122 10:36732891-36732913 ATACTCTTCCACTTTAAAGGCGG + Intergenic
1068170563 10:53388176-53388198 GTGCTAATCTAGATTAAAGATGG - Intergenic
1069971155 10:72170643-72170665 GAAATGTTCCAGATTCAAGGAGG + Intronic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1073241278 10:102060246-102060268 GGAATCTTCCAGAATAAAGGAGG - Intergenic
1073681188 10:105705276-105705298 GGACTACCCCAGCTTAAAGGGGG - Intergenic
1074781491 10:116805349-116805371 GTTCTATTCCATTTTAAAGCTGG + Intergenic
1078181098 11:9011526-9011548 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1078895299 11:15592082-15592104 GTAATATTCCAAGTTAGAGGTGG + Intergenic
1079149985 11:17889539-17889561 AAGCTATTCCAGAATAAAGGAGG + Intronic
1079970562 11:27031148-27031170 TTACTATTCTAGATTTCAGGTGG - Intergenic
1080727429 11:34912581-34912603 GTGCTCATCCAGATTAAGGGTGG - Intronic
1081323530 11:41718781-41718803 GTGCTCATCCAGATTGAAGGTGG - Intergenic
1081511895 11:43783098-43783120 AGACTGTTCCAGATTGAAGGAGG + Intronic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1085422858 11:76379251-76379273 GTAATAATCCAGATTAATAGAGG - Intronic
1085983237 11:81750176-81750198 GTACTTTTCCTGATCAAAGCAGG - Intergenic
1093184497 12:16004054-16004076 GTACTTTTCCAGATTTCATGTGG - Intronic
1093239093 12:16647015-16647037 GTATTATTAGAGATGAAAGGAGG + Intergenic
1094531118 12:31275998-31276020 GGACTATTCTAGATTAAAAGAGG + Intergenic
1096859623 12:54515883-54515905 GTACTCTTCCAGGTTTGAGGGGG - Intronic
1100082496 12:90869991-90870013 GAACTATTCCAGATTGATAGGGG - Intergenic
1106237855 13:27880117-27880139 GGAATGTTTCAGATTAAAGGAGG + Intergenic
1108028240 13:46201073-46201095 GAACTGTCCCAGATTAATGGAGG - Intronic
1110107636 13:71697712-71697734 GTGCTATTATAGTTTAAAGGTGG - Intronic
1110216852 13:73033195-73033217 GAACTATTCTAGATTAAAGAAGG - Intergenic
1110438963 13:75506973-75506995 GAACTGTTCCAGATTAAACAAGG + Intergenic
1110915001 13:81010418-81010440 GTACTATTCTAGGATAAAAGTGG + Intergenic
1112412346 13:99175378-99175400 GTACTATTCTAGATTAAAAGAGG + Intergenic
1112763218 13:102713528-102713550 TTACTATGACAGATTAAAGTTGG - Intergenic
1112824630 13:103377879-103377901 TTACTAATCCAGTATAAAGGAGG + Intergenic
1114005146 14:18304530-18304552 ATACTTTTCCACTTTAAAGGGGG + Intergenic
1115495171 14:33997075-33997097 GAACAATTCCAGATAAAATGAGG - Intronic
1116453152 14:45086687-45086709 GTATTATTTCAGGTTCAAGGGGG + Intronic
1116759877 14:48998812-48998834 GTACCCTCCCAGATTAAGGGTGG - Intergenic
1120409999 14:84142440-84142462 GGACTAGTCCAAATTAAAGCGGG - Intergenic
1121275530 14:92664982-92665004 GAGATATTCCAAATTAAAGGAGG - Intronic
1122147712 14:99702962-99702984 GAACTGTTCTAGAATAAAGGGGG - Intronic
1122926908 14:104907800-104907822 GTATTATTCAAGAGTGAAGGAGG + Intergenic
1123389602 15:19856763-19856785 ATACTTTTCCACTTTAAAGGGGG + Intergenic
1125644271 15:41258500-41258522 GAAATGTTCCAGATTAAAGGAGG - Intronic
1126446387 15:48749753-48749775 GAAATGTTCTAGATTAAAGGAGG + Intronic
1127743719 15:61941184-61941206 GTACTTCTCCAGACTCAAGGGGG + Intronic
1130747253 15:86668542-86668564 GAAATATTGCAGATAAAAGGGGG - Intronic
1131655957 15:94459140-94459162 ACACAATTCTAGATTAAAGGGGG - Intronic
1135876178 16:26202295-26202317 TAACTAATCCAGATTCAAGGTGG - Intergenic
1136502911 16:30682531-30682553 GTGGTATGCCAGATCAAAGGAGG + Intergenic
1139792121 16:69446805-69446827 AAACTGTTCCAGATTGAAGGAGG - Intronic
1142487841 17:258439-258461 TTCCTATTTCAGATTAAAAGAGG + Intronic
1142819417 17:2453344-2453366 GAACTATTCCAGATTGAAGGAGG - Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1150044841 17:61902342-61902364 GTCCAATTCCAAATAAAAGGAGG - Intronic
1153626805 18:7029057-7029079 TTACAATTCCAAATTAAATGTGG - Intronic
1153919770 18:9778215-9778237 GTGCCAGCCCAGATTAAAGGGGG + Intronic
1154532278 18:15359331-15359353 ATACTTTTCCACTTTAAAGGGGG - Intergenic
1155465332 18:26128291-26128313 GTACCCATCCAGATTAAGGGTGG - Intergenic
1157705440 18:49800954-49800976 GTCTTATTCCTGATTATAGGGGG - Intronic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1158433574 18:57416053-57416075 GGCCCATTCCAGATTCAAGGAGG - Intergenic
1159289787 18:66401691-66401713 GTACTTATGCAGATTAAATGGGG - Intergenic
1159391605 18:67800689-67800711 TTACTAATCTATATTAAAGGAGG + Intergenic
1160279301 18:77472426-77472448 GTGCTAACCCAGATTAAAAGTGG + Intergenic
1162221542 19:9181416-9181438 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1163963253 19:20717707-20717729 GTGCAATAACAGATTAAAGGTGG - Intronic
1167651271 19:50730733-50730755 GAAATGTTCCAGATTCAAGGAGG - Intergenic
1168490643 19:56805766-56805788 GAGGTTTTCCAGATTAAAGGAGG + Intronic
925242993 2:2349806-2349828 GTTCTAGTCCAGAGTAAATGAGG - Intergenic
929472307 2:42206556-42206578 GTTCAGTTCCAGATTAAAGTAGG - Intronic
930371267 2:50504099-50504121 GAAATGTTCTAGATTAAAGGAGG + Intronic
930726264 2:54684786-54684808 GAACTGTTCCAGATGAAAGGAGG + Intergenic
930790746 2:55325594-55325616 GTATTCTTCCTGATTAAAGGGGG + Intronic
930847386 2:55920490-55920512 GTCCTCTTCCATATTAAAGATGG - Intronic
930975469 2:57454113-57454135 GCACTATTCCAGAATGCAGGGGG + Intergenic
931295882 2:60925077-60925099 TTATTATTACAGATTAAAGTTGG + Exonic
931688418 2:64814739-64814761 GGCCTAACCCAGATTAAAGGAGG + Intergenic
932402787 2:71493340-71493362 GAAACGTTCCAGATTAAAGGAGG - Intronic
934615336 2:95767221-95767243 GTCCTAATCCAGAGTAAAAGGGG + Intergenic
934645570 2:96057338-96057360 GTCCTAATCCAGAGTAAAAGGGG - Intergenic
934838974 2:97613427-97613449 GTCCTAATCCAGAGTAAAAGGGG - Intergenic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
936461510 2:112717819-112717841 GAAATGTTCCAGATTACAGGAGG - Intergenic
938531375 2:132190559-132190581 ATACTTTTCCACTTTAAAGGGGG - Intronic
939440525 2:142243779-142243801 ATACTATTCAACAATAAAGGAGG + Intergenic
943429519 2:187781719-187781741 ATACTATTTCAGGTTAAAGAAGG - Intergenic
943490433 2:188547614-188547636 GTGCCCATCCAGATTAAAGGTGG + Intronic
943981257 2:194554193-194554215 GTACTATTCCAAAAAAATGGTGG - Intergenic
944388313 2:199189282-199189304 GTGCTCATCCAGATTAAGGGTGG + Intergenic
944424841 2:199569693-199569715 GTTCTTTTCCAGGGTAAAGGTGG - Intergenic
945379405 2:209121740-209121762 GTGCTAACCCAGATTAAGGGCGG + Intergenic
946536694 2:220637905-220637927 GTACTCTTACAGGTTATAGGAGG + Intergenic
1168775326 20:442478-442500 GAACTGTTCCAGATTAAAAATGG + Intronic
1169750186 20:8984196-8984218 GCAGTGTTCCAGATCAAAGGAGG - Intergenic
1170408455 20:16063960-16063982 GAACTGTCCCAGATTAAAGGAGG + Intergenic
1170722796 20:18898741-18898763 GTACTGTTCCTGATTGCAGGAGG - Intergenic
1171038057 20:21732776-21732798 GAACTGTTCCAGATGAAAGGAGG - Intergenic
1172209864 20:33189557-33189579 GTACTAATCCATTTTAAGGGAGG + Intergenic
1175398738 20:58686755-58686777 GGACTGTTCTGGATTAAAGGAGG + Intronic
1176765084 21:13008870-13008892 ATACTTTTCCACTTTAAAGGGGG + Intergenic
1177004083 21:15649131-15649153 GTACTAGTCCAGATGAAGGAAGG + Intergenic
1177460349 21:21400859-21400881 GCACTAGTCCATATAAAAGGTGG - Intronic
1177722151 21:24920727-24920749 GTACTATTCCGCTTTAAAAGAGG + Intergenic
1178012152 21:28301060-28301082 GTGCTCATCCAGATTAAGGGTGG - Intergenic
1178062054 21:28863149-28863171 GTGCTCACCCAGATTAAAGGTGG - Intergenic
1178264347 21:31128836-31128858 TTACTCTTCCAAATTAAATGAGG - Intronic
1178436258 21:32561265-32561287 TTACTATTCCACCCTAAAGGTGG - Intergenic
1178613282 21:34106878-34106900 GAAGTAGTCCAGATTAAAGGGGG - Intronic
1179084011 21:38201289-38201311 GTACTCATCCAGATTAAGGGTGG - Intronic
1179216259 21:39369612-39369634 GAAATGTTTCAGATTAAAGGAGG + Intergenic
1180429658 22:15235322-15235344 ATACTTTTCCACTTTAAAGGGGG + Intergenic
1180512269 22:16103661-16103683 ATACTTTTCCACTTTAAAGGGGG + Intergenic
1182701498 22:32243316-32243338 GAAATGTTCCAGATGAAAGGAGG + Intronic
949870846 3:8587062-8587084 GTACCCATCCAGATTAAGGGTGG + Intergenic
949927804 3:9056111-9056133 GTACTATTCCATCTTATAAGTGG + Intronic
952100761 3:30010465-30010487 GCACTGTTCCAGATTAAAGGTGG - Intergenic
952273509 3:31855339-31855361 GAAGTGTTCCAGATTAAATGAGG - Intronic
952773871 3:37026037-37026059 GTTTTATTACAGAATAAAGGAGG - Intronic
952952391 3:38535515-38535537 GAACTCTCCCAGATTAAAGGAGG - Intronic
953593483 3:44284055-44284077 GAAATGTTCTAGATTAAAGGAGG - Intronic
953661161 3:44892763-44892785 AAATTGTTCCAGATTAAAGGAGG - Intronic
954013643 3:47665531-47665553 GTTTTTTTCCAGAATAAAGGTGG + Intronic
955728323 3:61956840-61956862 GTACTATTCCAGGATAAAGAGGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956413638 3:69004472-69004494 GTTATATACCAGATTTAAGGAGG - Exonic
956838764 3:73117630-73117652 TTACGATTCTACATTAAAGGAGG + Intergenic
957247984 3:77736921-77736943 GTGCTAACCCAGATTAAGGGAGG + Intergenic
957276213 3:78094048-78094070 GTACAATTCAAGATGAAAGTTGG - Intergenic
958715285 3:97773323-97773345 GTACTCAGCCAGATTAAGGGTGG + Intronic
958858980 3:99422090-99422112 GAACTACTTTAGATTAAAGGGGG + Intergenic
958894571 3:99815518-99815540 GTATTATTAGAGTTTAAAGGAGG - Intergenic
959901319 3:111664745-111664767 AAAATATTCTAGATTAAAGGAGG + Intronic
962690460 3:137891992-137892014 GTAGTATCATAGATTAAAGGTGG + Intergenic
963261028 3:143191085-143191107 GTGCTATTCGGGATTTAAGGAGG - Intergenic
963299301 3:143581120-143581142 GTACTATTTTAGAATAAAGGAGG + Intronic
964465760 3:156990077-156990099 GAAATATTCTAGATTAAAGGAGG - Intronic
965068571 3:163885739-163885761 TAACTGTTCCAGATTAAAGTAGG - Intergenic
965586869 3:170326732-170326754 GTACTGGTCCAGATTAACGCAGG - Intergenic
971729831 4:30362773-30362795 TTTCTATTCCAGGTTAAAAGTGG - Intergenic
972535726 4:39998310-39998332 GTAGTAATCCAGATTAAAAGGGG + Intergenic
973956694 4:56069805-56069827 AGACTATACCAGATCAAAGGAGG + Intergenic
975146828 4:70977236-70977258 GCACATTTCCAGATCAAAGGAGG - Intronic
975255183 4:72226550-72226572 GGACTATCGCAGATTAAAGAGGG + Intergenic
976428879 4:84939105-84939127 GAAGTGTTCCAAATTAAAGGAGG - Intronic
977176306 4:93824587-93824609 GAACTATTCCAGGGTAGAGGTGG - Intergenic
977734788 4:100400564-100400586 GTACTATCCCAGATATAAGGAGG - Intronic
979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG + Intronic
981554449 4:145977766-145977788 GAACTATTCCAGCCTGAAGGAGG + Intergenic
984650992 4:182270383-182270405 ATGCTATTCCAGACTGAAGGTGG + Intronic
984928842 4:184828657-184828679 GTATTATTCCTGATTTAAGGAGG - Intergenic
986507682 5:8469990-8470012 CTACAATTCAAGATTAAATGTGG + Intergenic
987900968 5:24011673-24011695 GTACCATATCAGATTAATGGTGG - Intronic
988076777 5:26364046-26364068 GTACTATTTCAGATAAAACCAGG - Intergenic
988960228 5:36363518-36363540 ATACCATCCCAGATTGAAGGAGG + Intergenic
989341832 5:40384841-40384863 GTACTTTTTCAGATTTAAGAGGG + Intergenic
991254792 5:64602060-64602082 GTACTACTCCAGACTAATGTGGG + Intronic
994076327 5:95653950-95653972 GGACTTTTCAAGATTAATGGAGG - Intronic
994892866 5:105660857-105660879 AGACTATTCCAGATAAAAGATGG - Intergenic
995446769 5:112253438-112253460 AAAGTGTTCCAGATTAAAGGAGG + Intronic
996511902 5:124325894-124325916 GGACTGTTCCAGATTAAAAGTGG + Intergenic
997117771 5:131144385-131144407 GAACTGTTCTAGATTAAAAGAGG - Intergenic
998195775 5:140069455-140069477 GAAATGTTCCAGATTTAAGGTGG + Intergenic
998245071 5:140493363-140493385 GTACTATTTAAAAATAAAGGTGG - Intronic
998641068 5:144011892-144011914 TTACTATTCCACCTCAAAGGCGG - Intergenic
999068637 5:148718408-148718430 GTTCTGTACCATATTAAAGGTGG - Intergenic
999513997 5:152282115-152282137 GTACTATTCCATTTTACAGTTGG + Intergenic
1000599099 5:163250725-163250747 GGACTACTCTAGATTAAAAGAGG + Intergenic
1001439157 5:171725481-171725503 CTCCTTTTCCAGATTAAAGAAGG - Intergenic
1001569998 5:172724466-172724488 CAACTACTCCAGATGAAAGGCGG + Intergenic
1003677933 6:8224138-8224160 GTGCTCATCCAGATTAAGGGTGG - Intergenic
1003789581 6:9528630-9528652 GAACTATTCCAAATTGAAGGAGG + Intergenic
1004112922 6:12738112-12738134 AAATTATTCCAGATTAAAGAAGG - Intronic
1005851562 6:29827282-29827304 CAACTTTTCCAGATTTAAGGGGG + Intronic
1008279547 6:49579475-49579497 GAATTGTTCTAGATTAAAGGAGG + Intergenic
1011222429 6:85069484-85069506 GGACTATTCTAGAGTACAGGAGG - Intergenic
1011929975 6:92699907-92699929 GAATTATTCCAGAATAATGGAGG - Intergenic
1012366378 6:98445655-98445677 GTACCCATCCAGATTAAGGGTGG - Intergenic
1012426930 6:99124958-99124980 GAAATGCTCCAGATTAAAGGAGG + Intergenic
1012580184 6:100858926-100858948 GTACTATTGTAGATTAAAAGAGG - Intronic
1017655232 6:156621164-156621186 GAACTGTTGCAAATTAAAGGAGG + Intergenic
1021855723 7:24853483-24853505 GAACTGTTCCCAATTAAAGGAGG + Intronic
1021982637 7:26069406-26069428 TTACTCTTCCAGAATAAAAGGGG + Intergenic
1022381505 7:29865061-29865083 GTTGTAGTGCAGATTAAAGGAGG - Intronic
1022873660 7:34505781-34505803 GAGCAATTCCTGATTAAAGGTGG - Intergenic
1024725147 7:52185706-52185728 GTGCTCATCCAGATTAAGGGTGG - Intergenic
1027781474 7:82525865-82525887 GAACTCTTCCATACTAAAGGAGG + Intergenic
1028141299 7:87278393-87278415 GTACCCATCCAGATTAAGGGTGG - Intergenic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1030757862 7:113311291-113311313 GTATTATTCAAGACTTAAGGTGG + Intergenic
1031570582 7:123354305-123354327 CAACTAGTCCAGATTAAAGAGGG - Intergenic
1037572357 8:20169250-20169272 GAACTTTTCCAGATTAAAAGAGG + Intronic
1039243016 8:35577330-35577352 GAACTTATCCAGATTAAAGAAGG - Intronic
1039900011 8:41744963-41744985 GGCCTATTCCAGATGGAAGGAGG + Intronic
1043222793 8:77687731-77687753 GTACTATTCCAGATGAGATTTGG - Intergenic
1043571871 8:81613146-81613168 GAAATGTTCCAGATCAAAGGAGG + Intergenic
1044708738 8:95034494-95034516 GAAATGTTCCAGAATAAAGGAGG - Intronic
1047363056 8:124186634-124186656 GAACTATTCAAGATGAAAGGAGG + Intergenic
1053709985 9:40797056-40797078 ATACTTTTCCACTTTAAAGGGGG - Intergenic
1054419890 9:64917850-64917872 ATACTTTTCCACTTTAAAGGGGG - Intergenic
1054768078 9:69059304-69059326 GTACCATTCCAGCTTCAAGCTGG + Intronic
1055892716 9:81140718-81140740 TTACTATGGCAGATTAAAGATGG - Intergenic
1056372458 9:85970755-85970777 GAAATGCTCCAGATTAAAGGAGG + Intronic
1059547178 9:115188813-115188835 GTATTATTCCACGATAAAGGTGG - Intronic
1059692182 9:116696386-116696408 GTATTTTTCCATTTTAAAGGTGG + Intronic
1060429008 9:123532408-123532430 GAACTATTCTAGATTAAAGGAGG - Intronic
1186938998 X:14483838-14483860 GTGCTCACCCAGATTAAAGGTGG - Intergenic
1187552536 X:20320498-20320520 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1187705757 X:22007806-22007828 AAAAGATTCCAGATTAAAGGAGG + Intergenic
1188839243 X:34994911-34994933 TTACAATTCCAGATTAAAGTTGG - Intergenic
1189009601 X:37034003-37034025 GAACTAGTCCATATTAAAGGAGG - Intergenic
1189038973 X:37521715-37521737 GAACTAGTCCATGTTAAAGGAGG + Intronic
1190386182 X:49884224-49884246 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1190885253 X:54526018-54526040 GTATTATTCTAGATTAAAAGAGG + Intergenic
1192856419 X:75017469-75017491 GTACAATTCAAGATTAAATTTGG + Intergenic
1193698719 X:84739302-84739324 GAACTTCTCCAGAATAAAGGAGG - Intergenic
1194738979 X:97549745-97549767 GAACTGTTCCAGATTAAAGGAGG - Intronic
1195798347 X:108678889-108678911 GAACTGTTTCAGATTAAAGAAGG - Intronic
1196940139 X:120767706-120767728 GAAATGTTCCAGATTAAAAGAGG - Intergenic
1197420193 X:126228848-126228870 GTACCCACCCAGATTAAAGGTGG - Intergenic
1198440815 X:136661288-136661310 GTACTATTCCAGAAGAGAGATGG - Intergenic
1199040569 X:143110945-143110967 GTACCCACCCAGATTAAAGGTGG - Intergenic