ID: 1070277862

View in Genome Browser
Species Human (GRCh38)
Location 10:75024961-75024983
Sequence CTTTTCTTCTTTAGTACAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1048
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 971}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070277862_1070277866 -7 Left 1070277862 10:75024961-75024983 CCTTTTGTACTAAAGAAGAAAAG 0: 1
1: 0
2: 3
3: 73
4: 971
Right 1070277866 10:75024977-75024999 AGAAAAGGGGTCGTAAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 53
1070277862_1070277867 -4 Left 1070277862 10:75024961-75024983 CCTTTTGTACTAAAGAAGAAAAG 0: 1
1: 0
2: 3
3: 73
4: 971
Right 1070277867 10:75024980-75025002 AAAGGGGTCGTAAACGCAGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070277862 Original CRISPR CTTTTCTTCTTTAGTACAAA AGG (reversed) Exonic
900211888 1:1460250-1460272 TTTTTCTTTTTTAGTAGAGATGG + Intronic
900232298 1:1566089-1566111 TTTTTTTTTTTTAGTAGAAACGG - Intronic
900718216 1:4158552-4158574 TTTTTCATTTTTAGTACAGATGG - Intergenic
901106044 1:6757531-6757553 CTTTTTTTTTTTAGTAGAGATGG + Intergenic
901108690 1:6778118-6778140 TTTTGCATTTTTAGTACAAACGG + Intergenic
901312537 1:8280448-8280470 TTTTTTTTCTTTAGTAGAGATGG - Intergenic
901360561 1:8695577-8695599 TTTTTTTTTTTTAGTAGAAATGG - Intronic
901520317 1:9778842-9778864 TTTTTTTTTTTTAGTACAGACGG - Intronic
902906248 1:19559992-19560014 CATTTCTTCTTTAATAAATAAGG - Intergenic
902994113 1:20210589-20210611 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
903760642 1:25695851-25695873 CGTCTCTTCATCAGTACAAAGGG + Intronic
903792104 1:25900751-25900773 CTTTTCTACTTCAGTACACTTGG - Intronic
903890058 1:26563528-26563550 CTTTTCTTCTTTTTTAAAACTGG + Intronic
904176434 1:28633033-28633055 TTTTTTTTATTTAGTACAGACGG + Intronic
904539010 1:31220185-31220207 TTTTTTTTTTTTAGTACAGACGG + Intronic
904553523 1:31341730-31341752 CTTAGCTTCTTTACTATAAAAGG + Intronic
904643776 1:31950437-31950459 CTTTTGTATTTTAGTACAGATGG - Intergenic
905138800 1:35823752-35823774 ATTTTTTTTTTTAGTACAGATGG + Intronic
905598677 1:39231385-39231407 CTTTTCTTTTTTAATAGAGAAGG + Intronic
905605068 1:39290843-39290865 ATTTTTTTTTTTAGTAGAAATGG + Intronic
905995238 1:42375744-42375766 ATTTTTTTTTTTAGTACAGATGG + Intergenic
906099496 1:43249612-43249634 TTTTTTTTTTTTAGTAGAAATGG + Intronic
906425786 1:45711160-45711182 CTTTTCTATTTTAGTAGAGATGG - Intronic
906539240 1:46572388-46572410 CTTTTTTTTTTTAGTAGAGATGG + Intronic
906728724 1:48063283-48063305 CTTCTCTTCCTCACTACAAAGGG - Intergenic
906812785 1:48846205-48846227 CCTTTCTTTTAAAGTACAAATGG - Intronic
906981635 1:50637263-50637285 TTTTTTTTTTTTAGTAGAAATGG - Intronic
907433962 1:54431934-54431956 ATTTTTTTTTTTAGTAGAAATGG - Intergenic
907682244 1:56575520-56575542 TTTTTCTGCTTTGGTGCAAATGG + Intronic
908052085 1:60244354-60244376 CTTTTATCCTTTAATTCAAACGG - Intergenic
908466135 1:64397512-64397534 ATTGTTTTCTTTAGTACCAAAGG - Intergenic
908669462 1:66530758-66530780 TTTTTTTTTTTTAGTAGAAAGGG - Intergenic
908869444 1:68592050-68592072 CCTTTCTTCCATATTACAAATGG - Intergenic
908903456 1:68982057-68982079 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
908992004 1:70102790-70102812 CTTTTCCTCATCAGTACAATGGG - Intronic
909411293 1:75354837-75354859 CCTTTCTTCTTGAGAACATAGGG - Intronic
909497813 1:76298974-76298996 CTTTTCTTCCTGAGTAAAATAGG - Intronic
909553017 1:76920498-76920520 CTTATCTACTTTACTAAAAATGG + Intronic
909771463 1:79427438-79427460 CTTTTCTTTTTTAATACATGAGG + Intergenic
909930722 1:81496357-81496379 CTTTTTTTCTTTAGCAAAAAAGG + Intronic
910216030 1:84845551-84845573 GTTTTCTTTTCTAGTTCAAAAGG - Intronic
910479203 1:87640190-87640212 TTTTTGTACTTTAGTAGAAACGG + Intergenic
910840360 1:91555340-91555362 CTTCTCTTCTCTACTAAAAAAGG - Intergenic
910966600 1:92814431-92814453 CTTTTTTTTTTTAGTACAGACGG + Intergenic
911110916 1:94184317-94184339 AAATTCTTCTTTAGTACAAATGG + Intronic
911888158 1:103329908-103329930 CTTTTCTTCTTTTTTGCAAATGG - Intergenic
912283687 1:108345529-108345551 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
912508449 1:110172443-110172465 CTTTTCCTCCTTAGCACCAATGG - Intronic
912593096 1:110847360-110847382 CATTTGTTCTTTAGAACTAAAGG - Intergenic
912840925 1:113038386-113038408 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
912847464 1:113087812-113087834 CTATTCTCCTTTACTGCAAATGG - Intronic
912865792 1:113255160-113255182 CTTTTCTTCTTTAGTGGAGAGGG + Intergenic
912910601 1:113755886-113755908 CTTTTTTTTTTTAGTAGAGACGG - Intronic
913181254 1:116324337-116324359 CTTTTGTATTTTAGTAGAAACGG - Intergenic
913239438 1:116817117-116817139 TTTTTTTTCTTTAGTAGAGACGG + Intergenic
913273485 1:117116811-117116833 CTTTTTCTCTTCAGAACAAAGGG + Intronic
913298447 1:117344978-117345000 CTTTTCTTATTTAATAAAAATGG - Intergenic
913446579 1:118956778-118956800 TTTTTTTTTTTTAGTAGAAACGG - Intronic
915159207 1:153905012-153905034 TTTGTCTTCTTTAGTAGAGACGG + Intronic
915995034 1:160553378-160553400 CTTGTCTTCTCTTGAACAAACGG + Exonic
916064467 1:161124788-161124810 TTTTTCTTTTTTTGTAGAAACGG - Intronic
916214107 1:162381554-162381576 CATTTTTTCTTTACTCCAAAGGG + Intronic
916277261 1:163008223-163008245 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
917133074 1:171762072-171762094 CTTTCCTTCTTTAGTGGACATGG - Intergenic
917213865 1:172658123-172658145 CTTTTTTTTTTTTGTACAGATGG - Intergenic
918081329 1:181209884-181209906 CTTTTCAATGTTAGTACAAATGG - Intergenic
918265513 1:182838707-182838729 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
918519236 1:185397088-185397110 CTTTTTTTTTTTGGTAGAAATGG + Intergenic
918549706 1:185728005-185728027 TTTTTTCTCTTTAGTACCAAAGG + Intergenic
918640658 1:186837555-186837577 TTTTTTTTTTTTAGTACAGATGG - Intronic
918912012 1:190585620-190585642 ATTTTTTTCTTTAATACAATAGG - Intergenic
919305095 1:195822182-195822204 TTTTTTTTTTTTAGTACAGACGG - Intergenic
919339023 1:196279598-196279620 TTTTTTTTTTTTAGTAGAAATGG + Intronic
920107701 1:203565982-203566004 GTTTTCTTCTTTAGAACATGAGG - Intergenic
920627900 1:207621101-207621123 TTTTTATTTTTTAGTACAGATGG - Intronic
921485836 1:215714561-215714583 TTTTTCTTTTTTAGTTTAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922010498 1:221579714-221579736 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
922425711 1:225490675-225490697 CCTTTCTTCTTTATTACTAGAGG - Exonic
922992434 1:229925812-229925834 TTTTTCTTTTTTAGGAGAAAAGG + Intergenic
923590845 1:235318342-235318364 ATTTTTTTATTTAGTACAGATGG + Intronic
923905890 1:238383258-238383280 TTTTTTTTTTTTTGTACAAAGGG - Intergenic
923986153 1:239385097-239385119 CCTTTCTCCTTTAGTACACAAGG + Intergenic
924228819 1:241946086-241946108 ATTTTTTTTTTTAGTAGAAATGG + Intergenic
924334740 1:242976066-242976088 TATTTCTTTTTTAGTACAGACGG + Intergenic
924362849 1:243259227-243259249 ATTTTTTTTTTTAGTACAGACGG - Intronic
1062904691 10:1171860-1171882 CTTTTCTTCTTTCTTGTAAAGGG - Intergenic
1063268590 10:4481966-4481988 CTTTTCTTCTTCCTTCCAAAGGG - Intergenic
1063280393 10:4623120-4623142 CTTTTCTACTTGAAGACAAATGG - Intergenic
1063513779 10:6673405-6673427 CTTCTCTTCTTTAGAACAGAAGG - Intergenic
1063575105 10:7254647-7254669 TTTTTTTTCTTTAGTAGAGATGG - Intronic
1063619412 10:7631967-7631989 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1063924266 10:10962057-10962079 CTTTTCTTTTTTTGTAGAGATGG - Intergenic
1064013166 10:11752288-11752310 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1064200753 10:13282989-13283011 TTTTTCTTTTTTAGTAGAAGTGG + Intronic
1064850930 10:19707776-19707798 TTTTTTTTTTTTAGTACAGATGG - Intronic
1064851097 10:19709233-19709255 TTTTTTTTTTTTAGTACAGACGG - Intronic
1065160777 10:22919095-22919117 CTTTTTGTCTTTAGTAGAGATGG + Intergenic
1065398761 10:25271808-25271830 TTTTTTTTCTTTAGTAGAAATGG + Intronic
1065405512 10:25358905-25358927 ATATTCTTCTTAAGTACACATGG - Intronic
1065633690 10:27708996-27709018 TTTTTTATCTTTAGTACAGACGG - Intronic
1065724423 10:28655971-28655993 TGTTTCTACTTTAGGACAAATGG - Intergenic
1065919206 10:30376564-30376586 CTTTTCTTCTTTAGTAAGTTTGG - Intergenic
1066253572 10:33656823-33656845 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1066384664 10:34932002-34932024 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1067178183 10:43964809-43964831 GTTTCCTTCCTTAGAACAAAGGG - Intergenic
1067933569 10:50588218-50588240 CATTTCTGATTTAGAACAAAAGG - Intronic
1068102261 10:52570058-52570080 CATTTCATCTTTAGTACCTAAGG - Intergenic
1069392267 10:67949079-67949101 ATTTTATTTTTTAGTAGAAACGG - Intronic
1070101142 10:73388023-73388045 CTTTTTATTTTTAGTACAGATGG + Intronic
1070277862 10:75024961-75024983 CTTTTCTTCTTTAGTACAAAAGG - Exonic
1070687900 10:78503280-78503302 CTTTCCTTGTTTAGTATACATGG + Intergenic
1071479360 10:86053230-86053252 CTTTTGTTTTTTATTACACAAGG - Intronic
1071554278 10:86590394-86590416 CTTTTTTTTTTTAGTAGAGACGG - Intergenic
1071928107 10:90434708-90434730 CTTTTCTTTCTTGCTACAAATGG + Intergenic
1072088017 10:92099681-92099703 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1072635952 10:97178173-97178195 GTTTTCTTCTTTGGTATTAACGG - Intronic
1072919601 10:99565139-99565161 TTTTTTTTTTTTAGTACAGATGG + Intergenic
1073226426 10:101924525-101924547 CTTTTTTTTTTTAGTAGAGACGG + Intronic
1073571601 10:104584974-104584996 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
1073615417 10:104990341-104990363 ATTTTCTACTTTAATACCAATGG + Intronic
1073747659 10:106487981-106488003 TTTTTCTTGTTTAGAAGAAAGGG + Intergenic
1073793981 10:106968030-106968052 TTTTTTTTCTTTAGTAGAGACGG - Intronic
1074233966 10:111566156-111566178 CTTCTCTTCTTTAGGATTAAAGG - Intergenic
1075757039 10:124821081-124821103 TTTTTTGTTTTTAGTACAAACGG + Intronic
1075804135 10:125173170-125173192 CTTTTTTATTTTAGTAGAAATGG + Intergenic
1075843517 10:125525607-125525629 CTATTTTTTTTTAGTAGAAATGG + Intergenic
1075939346 10:126375909-126375931 CTTTTTTTTTTTTGTAGAAATGG + Intronic
1076051342 10:127336021-127336043 TTTTTTTTTTTTAGTACAGACGG + Intronic
1076090282 10:127679699-127679721 TTTTTTTTCTTTTTTACAAATGG - Intergenic
1076155757 10:128204158-128204180 CTTTTCCTTTTTAGGACATATGG + Intergenic
1076711891 10:132340791-132340813 CTTTTTTTTTTTAGTAGAGACGG - Intronic
1077268220 11:1662517-1662539 CTGTTATTCTTCACTACAAAAGG - Intergenic
1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG + Intergenic
1077872717 11:6276368-6276390 CTTTTCTTCTTTTTTAAAATAGG - Intergenic
1077967670 11:7153155-7153177 TTTGTATTCTTTAGTACAGACGG + Intergenic
1077970965 11:7189547-7189569 CTTTTCTTTAGTAGAACAAAAGG + Intergenic
1078023190 11:7672255-7672277 CTTTTCTTCATTATTCCAATTGG - Intronic
1078209545 11:9259384-9259406 CTTTTTTTTTTTAGTAGAGATGG - Intronic
1078571600 11:12462769-12462791 CATTTCTACTTTATTAAAAAGGG - Intronic
1079067715 11:17311914-17311936 CTTTACCTCTTTAGTAAATAGGG - Exonic
1079114115 11:17629694-17629716 CCTTTCTTCTTTAGTTCAGTGGG - Intronic
1079191522 11:18281575-18281597 CTTTTTTTTTTTAGTAGAGATGG + Intronic
1079857840 11:25628551-25628573 TTTTTCTTCTTTAGTAGAGATGG + Intergenic
1079897124 11:26134574-26134596 CTAATTTTTTTTAGTACAAAGGG - Intergenic
1079940856 11:26678672-26678694 CATATCTTCTTTAGTCCCAAAGG + Intronic
1080284481 11:30592931-30592953 ATTTCATGCTTTAGTACAAAGGG + Intergenic
1081161778 11:39758274-39758296 CTTTTCTTCTTTAGTAGTCTTGG - Intergenic
1081228008 11:40548792-40548814 TTTTTCTTATTTATTACATAGGG - Intronic
1081540312 11:44030073-44030095 TTTTTTTTTTTTAGTATAAAGGG + Intergenic
1081723897 11:45312073-45312095 GTTTTCTTTTTTATTATAAATGG + Intergenic
1081896166 11:46588603-46588625 CTTTTTTTTTTTAGTAGAGACGG - Intronic
1082184849 11:49166389-49166411 AGTTTCTTCTTTTATACAAAAGG + Intronic
1083402425 11:62433075-62433097 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1083605147 11:63974244-63974266 TTTTTTTTTTTTAGTACAGACGG + Intergenic
1087026751 11:93657565-93657587 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1087147442 11:94826112-94826134 TTTTTCTTTTTTAGTAGACATGG - Intronic
1087394076 11:97574189-97574211 CTTTTTTTTTTTAGTAGAGACGG + Intergenic
1087431245 11:98058050-98058072 CTTTTCTTCTTGAGTTTTAATGG - Intergenic
1087541611 11:99528891-99528913 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1087837128 11:102886446-102886468 CTTTTCTTCTTTTTGACACAGGG - Intergenic
1088231246 11:107675701-107675723 TTTTTTTTCTTTTGTAGAAATGG - Intergenic
1088650365 11:111952648-111952670 CTTTGTATTTTTAGTACAAATGG - Intronic
1088867266 11:113860637-113860659 TTTTTTTTCTTTAGTAGAGATGG - Intronic
1088885140 11:114000277-114000299 CTCTTCTTCTGTACAACAAAAGG - Intergenic
1089217279 11:116842086-116842108 CTTTTCTTCTCTAATCTAAATGG + Intergenic
1089375059 11:117988304-117988326 CCTTTCTTCTTTGGTAAAATTGG + Intronic
1089414354 11:118274689-118274711 CTTTCCTTCTCTACTACACAAGG - Intergenic
1089479712 11:118794257-118794279 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1089847912 11:121472788-121472810 TTTTGCATTTTTAGTACAAATGG - Intronic
1090074618 11:123572560-123572582 CATTTCTTCTTTTGTAGAGAAGG + Intronic
1091268887 11:134291802-134291824 TTTTTTTTCTTTAGTAGAAACGG - Intronic
1092136514 12:6152088-6152110 TTTTTTTTCTTTAGTAAAGATGG + Intergenic
1092415257 12:8286048-8286070 CTTTTCTTCTTTAGAATAAGTGG + Intergenic
1092479259 12:8845428-8845450 CTTTTCTTCTTTAGTTAATAGGG + Exonic
1092535509 12:9382770-9382792 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1092682177 12:10996143-10996165 CTTTTTTTTTTTAGTAGAGATGG - Intronic
1093041442 12:14384585-14384607 CTTCTCTTCAGTAGTACAGATGG - Intronic
1093070042 12:14699145-14699167 TTTTTTTTTTTTAGTACAGATGG - Intergenic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1093607147 12:21105911-21105933 TTTTACTCCTTTAGTATAAAGGG + Intronic
1094038208 12:26093405-26093427 CTTTTGTATTTTAGTACAGACGG - Intergenic
1094327468 12:29256356-29256378 CTTTTCATTTTTAGTAGAGACGG + Intronic
1094513139 12:31108339-31108361 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1094578727 12:31712824-31712846 TTTTTCTTTTTTAGTAGAGACGG + Intronic
1094623591 12:32102755-32102777 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1094665831 12:32519765-32519787 TTTTTCTTTTTTAGTAGAAACGG - Intronic
1094709732 12:32949505-32949527 ATTTTTTTCTTTGGAACAAATGG + Intergenic
1095052689 12:37568375-37568397 GTTTTCTTTTTTAGTAGAGACGG + Intergenic
1095452562 12:42348290-42348312 TTTTTTTTTTTTAGTAGAAACGG + Intronic
1095572198 12:43696255-43696277 CCTTTCTGCTTGAGTGCAAAAGG - Intergenic
1095708773 12:45266396-45266418 CTTTTATACTTTAATACATACGG - Intronic
1095753740 12:45739147-45739169 TTTTGCTTTTTTAGTAGAAATGG + Intronic
1096006037 12:48172888-48172910 TTTTTATTTTTTAGTACAGACGG + Intronic
1096061604 12:48705303-48705325 TTTTTCTTTTTTTGTAGAAATGG + Intronic
1096065672 12:48737993-48738015 TTTGTATTTTTTAGTACAAACGG + Intergenic
1096129740 12:49148514-49148536 TTTTTTTTCTTTAGTAGAGAGGG - Intergenic
1096437297 12:51604702-51604724 TTTTTCTTTTTTAGTAGAGATGG + Intronic
1096945280 12:55399971-55399993 TTTTTCTTTTTTAGTAGAGACGG + Intergenic
1097042867 12:56166320-56166342 TTTTTATTCTTTAGTAGAGACGG + Intronic
1097447701 12:59693002-59693024 ATTTTCTTTTTTTATACAAAAGG - Intronic
1097992646 12:65852324-65852346 ATTTTTTTCTTTAGTAGAGATGG - Intronic
1099335327 12:81348902-81348924 ATTTTGTTCTTGATTACAAATGG + Intronic
1100074202 12:90758777-90758799 CTATTTTTCTTTTGTACAACTGG + Intergenic
1100133163 12:91521202-91521224 ATTTTTTTTTTTAGTAGAAACGG + Intergenic
1100263331 12:92952890-92952912 CTTTTTTTTTTTAGTAGAGATGG - Intergenic
1100354971 12:93820367-93820389 TTTTTCTTTTTTAGTAGAGATGG - Intronic
1100831220 12:98517990-98518012 TTTTTTTTCTTTAGTAGAAACGG - Intronic
1100844849 12:98647243-98647265 TTTTTTTTTTTTAGTACAGACGG - Intronic
1101369472 12:104113061-104113083 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1101706846 12:107228490-107228512 GTTTTGTTCTTTCTTACAAAAGG - Intergenic
1102244231 12:111344937-111344959 CTTTTTTTGTTTAGTAGAGATGG + Intronic
1102272481 12:111549621-111549643 CTTTTCTTCTTTTATAGAAGAGG + Intronic
1102405400 12:112669188-112669210 CTTTTCTTAATTTGCACAAAGGG + Intronic
1102557646 12:113738362-113738384 CTTTTTTTTTTTAGTAGAGATGG + Intergenic
1102979637 12:117231137-117231159 GTTTTTTTCTTTAGTAGAGATGG - Intronic
1103130405 12:118463392-118463414 CTTTTCTTTTTTTGTAGAGATGG + Intergenic
1103198803 12:119069540-119069562 ATTTTCTCCTTTTGTACACAGGG - Intronic
1103525898 12:121568122-121568144 CTTTTCTCCATTATTTCAAAGGG - Intronic
1103635552 12:122302270-122302292 TTTTTCTTTTTTAGTAGAGATGG + Intronic
1103658505 12:122494379-122494401 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1103848678 12:123917180-123917202 TTTTTCTTTTTTTGTACAGATGG + Intronic
1104134973 12:125928758-125928780 CTTTTCTTCTATAAAATAAAAGG + Intergenic
1104192222 12:126493039-126493061 TGTTTCTTATTTAATACAAATGG - Intergenic
1104353495 12:128065452-128065474 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1105597509 13:21853117-21853139 GTATTCTTCATTAGTAGAAAAGG - Intergenic
1105777851 13:23679765-23679787 CTTTTCTTTTTTTGTAGAGATGG - Intergenic
1106607237 13:31240218-31240240 ATTTTCTGCTTTAGACCAAATGG + Intronic
1106624313 13:31404879-31404901 ATTTTTTTATTTAGTAGAAATGG + Intergenic
1106911507 13:34468060-34468082 CTTTATTTCTTTAGTAAAGATGG - Intergenic
1107074832 13:36311915-36311937 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1107264189 13:38532012-38532034 TTTTTCTTTTTTATTAAAAATGG - Intergenic
1107272059 13:38631497-38631519 TTTTTTTTCTTTAGTAGAGATGG + Intergenic
1107356966 13:39577809-39577831 CTTTTTTTTTTTAGTAGAGACGG + Intronic
1107505708 13:41030988-41031010 CTTTTATTTTTTTGTAGAAATGG - Intronic
1107537302 13:41348337-41348359 CTTCTATTTTTTAGTAGAAACGG + Intronic
1107583035 13:41812598-41812620 TTTTTCTTCTTTGGGACATACGG - Intronic
1107713749 13:43177807-43177829 TTTTTCATATTTATTACAAATGG + Intergenic
1108422019 13:50260492-50260514 ATTTTTTTTTTTAGTAGAAATGG + Intronic
1108650393 13:52472625-52472647 CTTTTCTTTTTTGGGAGAAAGGG - Intronic
1109063977 13:57660062-57660084 TTTTTCTTCTTTAGTATAGACGG - Intronic
1109473784 13:62849656-62849678 TTTTTCTTCTTTATTACATTAGG + Intergenic
1109509829 13:63355632-63355654 CATGTGTTCTTTAGAACAAATGG - Intergenic
1109611136 13:64765850-64765872 CTTTTCTTCCTTAGCAAAACTGG + Intergenic
1109851339 13:68068508-68068530 CTTTTCTTCTCAAGTTCACATGG - Intergenic
1110312138 13:74062757-74062779 TTTTTCTTTTTTAACACAAAAGG - Intronic
1110373038 13:74760553-74760575 CTCATCTTCTTTAGCACATAAGG - Intergenic
1110577058 13:77069682-77069704 TTTTTTTTTTTTAGTACAGACGG - Intronic
1110649085 13:77921769-77921791 CTTTTCTTCCATTTTACAAAAGG - Intergenic
1110857771 13:80315267-80315289 CCTTTCTTTTTTAGTAGCAAAGG - Intergenic
1111091956 13:83458614-83458636 TTTTTTTTGTTTAGTACAGACGG - Intergenic
1111744245 13:92245962-92245984 ATTTTCTTGTTTAGTATAAAGGG + Intronic
1111871313 13:93836009-93836031 CTTTTAGTCTTTAGTAAAACCGG + Intronic
1111922768 13:94430015-94430037 TTTTTTTTTTTTAGTAGAAAAGG + Intergenic
1112351624 13:98639716-98639738 ATTTTTTTTTTTAGTAGAAACGG - Intergenic
1112588212 13:100738505-100738527 CTTTTCCTCTTTAGGCCAAAGGG + Intergenic
1112725223 13:102295951-102295973 TTTTTCTTCTATAGTTCAAAGGG - Intronic
1112960856 13:105124249-105124271 CTTTTTTTTTTTAGTAGAGACGG - Intergenic
1113022376 13:105902080-105902102 CTTTTTTTTTTTAATAAAAAAGG - Intergenic
1113036632 13:106056995-106057017 GTTTTCTTCTTTAATTGAAATGG + Intergenic
1113453946 13:110433856-110433878 CTTTGCTTCTTAGGTAAAAAAGG + Intronic
1115137069 14:30123156-30123178 CATTTCTTTTTTAGGAAAAATGG + Intronic
1115198576 14:30828875-30828897 ACTTTCTTCTTAAGTACATATGG + Intergenic
1115252833 14:31367587-31367609 TTTTTTTTTTTTAGTACAGACGG + Intronic
1115312949 14:31997437-31997459 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1115665256 14:35537873-35537895 TTTTTGTTTTTTAGTAGAAACGG - Intergenic
1116139016 14:40965228-40965250 CTTTTCTTTTTTAATTCTAATGG - Intergenic
1116360345 14:43987811-43987833 TATTTCCTATTTAGTACAAAAGG + Intergenic
1116947524 14:50849401-50849423 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
1117057278 14:51925790-51925812 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1117114514 14:52495985-52496007 TTTTTCATTTTTAGTAGAAATGG - Intronic
1117219370 14:53586851-53586873 TTTATATTCTTTAGTACAGATGG - Intergenic
1117265487 14:54082058-54082080 ATTTTCTTCTATAATAAAAATGG - Intergenic
1117375847 14:55117604-55117626 CTTTTTTTTTAAAGTACAAAGGG + Intergenic
1117459570 14:55931639-55931661 CATTTCTTCTTTAAAAAAAAAGG - Intergenic
1117886320 14:60367844-60367866 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1118142649 14:63101586-63101608 CTTTTCTTCTTTGGTGGACACGG - Intronic
1118250347 14:64154158-64154180 TTTTTTTTTTTTAATACAAATGG - Intronic
1118525486 14:66635964-66635986 TTTTTTTTCTTTAGTAGAGACGG - Intronic
1118754197 14:68826488-68826510 CTTTTCTTTTTTTGTAGACAGGG - Intergenic
1118788776 14:69069465-69069487 TTTTTCTTCTTTTGTAGACACGG + Intronic
1118922368 14:70161070-70161092 CTTTTTTTTTTTAGTAGAGATGG - Intronic
1119290286 14:73490491-73490513 TTTTTCTTTTTTAGTAGAGACGG + Intronic
1119438578 14:74613119-74613141 ATTTTATTTTTTAGTACAGACGG + Intergenic
1119608257 14:76039956-76039978 CTTCTTTTCTTTTTTACAAAAGG + Intronic
1119739013 14:77001737-77001759 ATTTTCTTTTTTAGTAGAGATGG - Intergenic
1119929042 14:78526595-78526617 CATTTCTTTTTCAGTAAAAATGG + Intronic
1119982212 14:79094358-79094380 CCTTTCTGCTTTAATAAAAATGG - Intronic
1120074645 14:80141682-80141704 GTTGCCTTCTTTAGTAAAAAAGG + Intergenic
1120089312 14:80312646-80312668 CTTGTATTTTTTAGTACAGAAGG + Intronic
1120310326 14:82818504-82818526 CTTTTTTTTTTTAGTACAGATGG - Intergenic
1120342343 14:83237390-83237412 TTTTTTTTATTTAGTACAGACGG - Intergenic
1120503648 14:85327173-85327195 GTGTTCATCTTTAGAACAAAGGG + Intergenic
1121059567 14:90893459-90893481 CTTTTCTTCTCTACTTCACATGG - Intronic
1121200525 14:92113252-92113274 TTTTTGTTCTTTAGTAGAGATGG + Intergenic
1121325227 14:93015861-93015883 CTTTTCTTCACCAGGACAAAGGG - Intronic
1121382476 14:93485296-93485318 CTTTTCTTTTTTTTAACAAAGGG + Intronic
1121384236 14:93502685-93502707 CTTTTGTCCTATAGTTCAAATGG - Intronic
1123625695 15:22225507-22225529 CTTTTCTTTTTTTGTAGATATGG + Intergenic
1123831288 15:24140644-24140666 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1123879684 15:24665699-24665721 CTGATCTTCTTTAGAAGAAATGG - Intergenic
1123907145 15:24932402-24932424 TTTTTGTACTTTAGTAGAAACGG + Intronic
1123957955 15:25359737-25359759 CTGTTCTACTTTATCACAAAAGG + Intronic
1124133708 15:27014068-27014090 CTTTGCCTCTTTAGTACAATTGG + Intronic
1124604850 15:31162356-31162378 TTTTTGTTTTTTAGTACAGACGG - Intergenic
1124637125 15:31372354-31372376 CTCTTCTTTCTTATTACAAAAGG - Exonic
1124847760 15:33308962-33308984 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1124993788 15:34702347-34702369 CTTTTTTTTTTTAATACCAAGGG - Intergenic
1125091239 15:35795432-35795454 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
1125843506 15:42828541-42828563 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1126029079 15:44478273-44478295 ATTTTCTTTTTTAGTAGAGACGG - Intronic
1126281077 15:46949880-46949902 CTTTTTTTCTTTATTTAAAAAGG + Intergenic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1126634749 15:50769358-50769380 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1126840607 15:52714193-52714215 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1127044945 15:55015980-55016002 TTTTTCTCTTTTAGTAGAAACGG - Intergenic
1127108835 15:55646182-55646204 TTTTTTTTTTTTAGTACAGACGG + Intronic
1127137674 15:55941741-55941763 CTTTTTTTCTTTAGTAGAGGCGG + Intronic
1127139176 15:55956279-55956301 CTTTTCTTCTTTAAGAAACAAGG - Intronic
1127663032 15:61118331-61118353 CTTTTGTGCTTTAGTTCACAGGG - Intronic
1127669319 15:61179963-61179985 GTTTTTTTTTTTAGTAGAAACGG - Intronic
1128070992 15:64796902-64796924 CTTTTCTTTTTTAATAGAGATGG + Intergenic
1128180903 15:65602907-65602929 ATTTTCTTCTTTTGAAAAAAAGG - Intronic
1128272177 15:66319942-66319964 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1128631329 15:69271153-69271175 CTTTCCTTCTTCAGTGGAAAAGG - Exonic
1128839409 15:70837564-70837586 CTTTTATTCTTTAATAAATATGG - Intronic
1129418480 15:75403249-75403271 ATTTTTTTCTTTAGTAGAATGGG - Intronic
1129556453 15:76515246-76515268 CTTTCCTTCCTTAGTCCAAATGG - Intronic
1129865205 15:78902207-78902229 CCTTTCTCCTTTAAAACAAATGG + Intergenic
1130182947 15:81650168-81650190 CATTTCTTATTTATCACAAAGGG - Intergenic
1131055754 15:89373459-89373481 CTTTTTTTTTTAAGTACCAAGGG - Intergenic
1131236376 15:90700519-90700541 CCTTCCTTCTTGTGTACAAAAGG - Intergenic
1131527786 15:93166428-93166450 CATTTCTTCATTAGTACAATAGG - Intergenic
1132264511 15:100456774-100456796 TTTTGCATTTTTAGTACAAATGG - Intronic
1132790775 16:1686198-1686220 TTTTTCTTTTTTAGTAGAGATGG - Exonic
1133066989 16:3215249-3215271 CTTTTCTTTTTTAATAGAGATGG + Intergenic
1133234946 16:4383493-4383515 CTTTTATTTTTTCTTACAAAAGG - Exonic
1133421695 16:5651960-5651982 TTTTCTTTCTTTAGTAGAAATGG - Intergenic
1133443823 16:5842997-5843019 TTTTTTTTCTTTAGTAGAGACGG + Intergenic
1133485079 16:6212026-6212048 TTTTTCTTTTTTAGTAGAGATGG + Intronic
1133534364 16:6686673-6686695 ATTTTCTTCTTTAATGCTAAGGG + Intronic
1133668826 16:7997715-7997737 CTTTTTTTCTCTTGTAGAAATGG - Intergenic
1133682686 16:8135014-8135036 CCTTTCTTCTTCAGTAAAATTGG + Intergenic
1134326713 16:13214376-13214398 ATTTTTTTTTTTAGTAGAAACGG + Intronic
1134434602 16:14244444-14244466 CTTTTCTTTCGTAGTACTAAAGG - Intronic
1135067011 16:19318528-19318550 CTTTTTTTTTTTAGTAGAGACGG + Intronic
1135295122 16:21272836-21272858 TTTTTTTTTTTTAGTACAGATGG + Intronic
1135507824 16:23054005-23054027 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1135610329 16:23860713-23860735 CTTTTTTTTTTTAGTAGAGATGG - Intronic
1135881904 16:26265772-26265794 ATTTTCTTCATTATTTCAAACGG - Intergenic
1136098959 16:27979262-27979284 CTTTTTTTCTTTTTTAAAAATGG - Intronic
1136317165 16:29461120-29461142 TTTTTTTTCTTTAGTAGAGATGG - Intronic
1136431740 16:30200462-30200484 TTTTTTTTCTTTAGTAGAGATGG - Intronic
1136558854 16:31026280-31026302 ATTTTATTTTTTTGTACAAATGG - Intergenic
1137311717 16:47267921-47267943 CTTTTCTTCTTTTCTACTATAGG - Intronic
1137429696 16:48408617-48408639 TTTTTCATTTTTAGTACAGATGG + Intronic
1137529711 16:49271026-49271048 TTTTTTTTTTTTAGTACAGATGG - Intergenic
1137613040 16:49831818-49831840 CTTTTTTTTTTTAGTAGAGATGG - Intronic
1137663890 16:50236499-50236521 CTTTTATCCTTTAACACAAATGG + Intergenic
1137834300 16:51575785-51575807 TTTTTTTTCTTTAGTACAGGTGG - Intergenic
1137878028 16:52016102-52016124 CTTTTCTTCTTTAAGAGCAAAGG - Intronic
1138377467 16:56575718-56575740 CATTTCTTTTTTAGTAAAGACGG + Intergenic
1138405540 16:56789926-56789948 ATTTTCTGCTTTAGTAGAGACGG - Intronic
1138694909 16:58804036-58804058 CTTTTTCTCTTCAGAACAAAGGG - Intergenic
1139008099 16:62598488-62598510 TGTATCTTCTTTTGTACAAATGG + Intergenic
1139010299 16:62623465-62623487 CTTTTTTTTTTTAGTAGAGATGG - Intergenic
1139460473 16:67118143-67118165 TTTTTCTTTTTTAGTAGAGATGG + Intronic
1140356111 16:74308144-74308166 ATTTTCTTCATAAGTAGAAATGG - Intergenic
1140397501 16:74640984-74641006 CTTTTCTTGTTTAAAAAAAAAGG - Intronic
1140627559 16:76812313-76812335 CTTTTCTTGTTTAGATAAAAGGG + Intergenic
1141455983 16:84142613-84142635 TTTTTCTTTTTTAGTAGAGACGG + Intronic
1141522249 16:84588679-84588701 TTTTTATTCTTTTGTACAGATGG + Intronic
1141715261 16:85723394-85723416 TTTTTTTTTTTTAGTACAGATGG - Intronic
1141718064 16:85738499-85738521 TTTTTCATTTTTAGTAGAAATGG + Intronic
1141801978 16:86315935-86315957 TTTTTTTTTTTTAGTACAGATGG + Intergenic
1143211866 17:5193975-5193997 TTTTTATTTTTTAGTACAGACGG - Intergenic
1143470029 17:7167516-7167538 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1143680497 17:8472486-8472508 ATTTTCTTTTTTTGTAGAAACGG - Intronic
1143789172 17:9279861-9279883 CCTTTTTTCTTTAGTTCAAAAGG - Intronic
1144237841 17:13279296-13279318 TTTTTCTTCTTTGGTATAGATGG - Intergenic
1144532416 17:16052194-16052216 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1145373206 17:22324314-22324336 GTTTTCTTTTTTAGTAGAGAAGG + Intergenic
1145826306 17:27879669-27879691 CCTTTCTTCTTTAGTGAAAAAGG + Intronic
1146019795 17:29267825-29267847 CTTTTTTTCTTTGGTAGAGATGG + Intronic
1146114016 17:30117829-30117851 CTTCTCTTCTTTGATAAAAATGG + Intronic
1146797063 17:35789499-35789521 CTTTTCTTCTTTCTTACTATAGG + Intronic
1146858070 17:36271830-36271852 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1146988013 17:37240753-37240775 GTTGTCTTCTTTATTAAAAAAGG - Intronic
1147076939 17:37996713-37996735 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1147088390 17:38075893-38075915 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1147108820 17:38244630-38244652 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1147207819 17:38851074-38851096 CTTTTTCACTTTAGTACAGATGG - Intronic
1147796681 17:43048689-43048711 TTTTTTTTTTTTAGTACAGATGG + Intronic
1147856697 17:43486024-43486046 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1148116101 17:45176016-45176038 TTTTTCTTCATTTGTTCAAAGGG + Intergenic
1148221106 17:45862750-45862772 CTTTTCTTTTTTAGTAGAGACGG - Intergenic
1148420633 17:47543495-47543517 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1148609652 17:48956179-48956201 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1148657543 17:49298984-49299006 CTTTTTTTTTTTAATAGAAATGG + Intronic
1148833180 17:50449584-50449606 TTTTTTTTTTTTAGTAGAAACGG + Intronic
1149828993 17:59854761-59854783 CTTTTTTTTTTTAGTAGAGATGG - Intergenic
1150172193 17:63010060-63010082 GTTTTCTTTTTTAGAACAAGGGG + Intronic
1150175804 17:63054551-63054573 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1150182685 17:63141369-63141391 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1150388413 17:64777499-64777521 GGTTTGTTCTTTAGCACAAAGGG - Intergenic
1150417449 17:64998922-64998944 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1150728188 17:67668549-67668571 CTTTTCTTCTTTTGTAGAGATGG - Intronic
1150778081 17:68098172-68098194 TTTTTTTTTTTTAGTACAGACGG + Intergenic
1150794219 17:68225005-68225027 GTTTTTTTTTTTAGTAGAAACGG - Intergenic
1151221953 17:72619493-72619515 TTTTTATTTTTTAGTACAGATGG + Intergenic
1151520066 17:74621972-74621994 CTTTTCTTTTTTTGTAGAAATGG + Intronic
1151521969 17:74636630-74636652 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1151741915 17:75988941-75988963 TTTTTATTTTTTAGTAGAAACGG + Intronic
1151754478 17:76065277-76065299 CTTTTTTTCTTTTGTAAAGATGG - Intronic
1152844127 17:82588876-82588898 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1153876197 18:9373991-9374013 CATTTTTTATTTAGTACAAAAGG - Intronic
1154934153 18:21033844-21033866 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1155530494 18:26761515-26761537 CATTTTTTCTTTATTACATAAGG - Intergenic
1155772466 18:29719655-29719677 CAATTCTGCTTTATTACAAAGGG - Intergenic
1155808006 18:30196428-30196450 CTTTTTATTTTTAGTACAGATGG + Intergenic
1155869573 18:31009225-31009247 ATTTTTTTCTTTAGTAAAGATGG + Intronic
1155991582 18:32284409-32284431 CATTTCTTTTTTAGTACCAAGGG + Intronic
1156125038 18:33894044-33894066 CTTTGCTCCATTAGTACAGATGG + Intronic
1156221664 18:35059134-35059156 CTTTTCTTCACTAGTAAACAAGG - Intronic
1157198592 18:45640095-45640117 TTTTTTTTCTTTAGTAGAGATGG - Intronic
1157277307 18:46320661-46320683 CTTTTCTTCTTGGCTGCAAAAGG - Intergenic
1157916832 18:51672115-51672137 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1158079756 18:53576023-53576045 CCTTTCTTCCTTAATATAAATGG - Intergenic
1158634462 18:59144548-59144570 ATTTTTTTCTTTGGTAGAAATGG - Intronic
1158721758 18:59931501-59931523 TTTTTTTTTTTTAGTACAGATGG + Intergenic
1158996923 18:62931016-62931038 ATTTTCTTTTTTAGTAGAGATGG - Intronic
1159006887 18:63021242-63021264 CTCTTCTTTTCTAGTAAAAATGG - Intergenic
1159101014 18:63958983-63959005 TTTTTTTTCTTTTTTACAAATGG - Intronic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1160468460 18:79103922-79103944 CTTTTCTTCTGTGGTCCATATGG + Intronic
1161926836 19:7307077-7307099 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1162336346 19:10062945-10062967 CTTTTCTTTTTTAGTAGAGATGG - Intergenic
1162435809 19:10657628-10657650 CTTTTTTTTTTTAGTAGATACGG - Intronic
1162506071 19:11085977-11085999 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1162633186 19:11945004-11945026 CTTTTCTTCTTTAGAATAAGTGG + Intronic
1162773932 19:12967360-12967382 TTTTTTTTTTTTAGTAGAAATGG - Intronic
1162963200 19:14140816-14140838 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
1163272208 19:16261105-16261127 CTTTTCTTTTTTGGTAGAGATGG + Intergenic
1163937168 19:20457568-20457590 CTTTGCATTTTTAGTAGAAATGG + Intergenic
1164230209 19:23280520-23280542 CTTTTATACTTTAGTAGAGACGG - Intergenic
1164297338 19:23924222-23924244 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1164409386 19:27987314-27987336 CTTTAATTCTTTAGTACCTAAGG + Intergenic
1164544817 19:29151529-29151551 TTTTTATTTTTTTGTACAAATGG - Intergenic
1164823291 19:31266290-31266312 CTTTTATTTTTTGGTAGAAACGG - Intergenic
1166096041 19:40539787-40539809 ATTTTCTTCTTCAGTAAAATGGG + Intronic
1166110046 19:40616418-40616440 TTTTTTTTCTTTAGTAGAGATGG - Intronic
1166114303 19:40643599-40643621 TTCTTCTTCTTTTCTACAAATGG - Intergenic
1166834859 19:45661139-45661161 CTTTTGTATTTTAGTAGAAATGG + Intergenic
1167297398 19:48659684-48659706 CTTTTCTTTTTTAGTAGAGATGG - Intergenic
1167745547 19:51349613-51349635 CTTTTCTTTTTTGGTAGAGATGG + Intronic
1167836284 19:52074147-52074169 ATTTCCTTCTTTAGTACAGATGG - Intronic
1167841275 19:52123059-52123081 ATTTCTTTCTTTAGTACAGATGG - Intronic
1167989346 19:53344807-53344829 TTTTTCTTTTTTAGTAGAAACGG + Intronic
1168237630 19:55073497-55073519 TTTTTTTTTTTTAGTAGAAATGG + Intronic
1168669028 19:58227514-58227536 TTTTTCTTTTTTAGTAGAGACGG - Intergenic
925594539 2:5542489-5542511 CTTTTTTTTATTTGTACAAATGG - Intergenic
925682560 2:6438120-6438142 CTTGTATTTTTTAGTACAGACGG - Intergenic
925960915 2:9014752-9014774 ATTTTCTTTTTTAGTAGAGATGG - Intergenic
925975970 2:9142495-9142517 CTTTTTATTTTTAGTACAGAAGG + Intergenic
926401993 2:12506713-12506735 TTTTTCTTTTTTAGTAAAGACGG - Intergenic
926602834 2:14864536-14864558 TTTTTCATGTTTAGTAGAAAAGG - Intergenic
927498330 2:23565232-23565254 TTTTTCTTCTTCAGTAGAGATGG + Intronic
928224873 2:29440059-29440081 TTTTTTTTCTTTAGTAGAGACGG - Intronic
928508872 2:31983066-31983088 TTTTTCTTTTTTAGTAGAGATGG - Intronic
928525619 2:32136890-32136912 CTTCTCTTCTTTCACACAAAAGG - Exonic
928750446 2:34464569-34464591 CTTTTCTTCTTGAGAGGAAAGGG + Intergenic
928891868 2:36213583-36213605 AATTTCTTCTTTAGTCCAACAGG + Intergenic
929193742 2:39164137-39164159 TTTTTCATCTTTCGTACAGATGG + Intergenic
929632647 2:43480636-43480658 TTTTTTTTTTTTAGTAGAAATGG - Intronic
929662816 2:43806052-43806074 TTTTGCTTTTTTAGTAGAAACGG + Intronic
929705644 2:44209189-44209211 TTTTTTTTCTTTAATACACAGGG + Exonic
929840960 2:45462639-45462661 TTTTTTTTTTTTAGTACAGACGG - Intronic
930148948 2:48038579-48038601 ATTTTTTTTTTTAGTAGAAACGG + Intergenic
931057156 2:58485495-58485517 CTTTTCTTGACTAGAACAAAAGG - Intergenic
931635545 2:64338016-64338038 AGTTTCTTCATTAGTAAAAAGGG + Intergenic
932218469 2:69982564-69982586 ATTTTTTTCTTTAGTACAGCTGG - Intergenic
932654525 2:73598265-73598287 CTTGTTTTCTCTAGTACATAAGG - Intronic
932736460 2:74257885-74257907 CTTATCTTCTGTATTACAAGTGG - Intronic
932895198 2:75632693-75632715 CTTTTCTTCTTAACAGCAAAAGG + Intergenic
933043717 2:77506008-77506030 CATTTCTTTTTTAGTAGACATGG + Intronic
933382120 2:81561594-81561616 CTTTGCGTTTTTAGTACAGATGG - Intergenic
933959652 2:87399854-87399876 CTTTTCATATTTAGTAGAGATGG - Intergenic
935141642 2:100358264-100358286 CTTTTTTTTTTTAGTAGAGAAGG - Intergenic
935145850 2:100394891-100394913 TTTTTTTTTTTTAGTAGAAACGG + Intronic
935478740 2:103558892-103558914 TTTTTATTTTTTAGTAGAAATGG - Intergenic
935573887 2:104689335-104689357 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
935905368 2:107833226-107833248 CTTTTTTTTTTTAATTCAAACGG - Intronic
936786321 2:116097844-116097866 CTTTTCCTCATTAGCACAAAGGG + Intergenic
937541625 2:122962549-122962571 CTTTTTTTTTTTAGTAAAGAGGG + Intergenic
937934694 2:127233692-127233714 ATTTTCTTTTTTAGTAGAGACGG - Intergenic
938384842 2:130857974-130857996 TTTTTCTTTTTTAGTAGAGATGG + Intronic
938385223 2:130861451-130861473 TTTTTCTTTTTTAGTAGAGATGG + Intronic
938845574 2:135205446-135205468 TTTTTTTTCTTTTGTAGAAATGG + Intronic
938845586 2:135205524-135205546 GTTTTTTTCTTTTGTAGAAATGG + Intronic
939041750 2:137197840-137197862 CTATTCTCATTTAGTACAATGGG - Intronic
939397946 2:141655684-141655706 TTTTTCTTTTTTAATACAGAAGG + Intronic
939810705 2:146828437-146828459 CTTTCCTTCATTAGGAAAAAGGG + Intergenic
940107921 2:150118775-150118797 ATTTTTTTCTTTAGTACAGACGG - Intergenic
940507088 2:154569883-154569905 CTTTTCTTCTGTTATCCAAAAGG - Intergenic
940776042 2:157884790-157884812 CTTTTTTTCTTTTGGAGAAAGGG - Intronic
940905816 2:159168470-159168492 TTTTTGTTTTTTAGTAGAAATGG + Intronic
941045166 2:160666658-160666680 CTTTTCTTCCTTTGGTCAAAAGG - Intergenic
941542008 2:166798121-166798143 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
941866997 2:170345245-170345267 CCTTTCTTCATTAGTGCCAAAGG - Intronic
942055408 2:172177855-172177877 CATTTCTTTTTTAGAAGAAAAGG + Intergenic
942101081 2:172584838-172584860 TTTTTTTTTTTTTGTACAAACGG + Intronic
942132461 2:172893689-172893711 TTTGTCTTCTTTAGAAGAAAGGG + Intronic
942314373 2:174683830-174683852 CCTTTCTGCTTTAATTCAAAGGG - Intergenic
942370772 2:175281842-175281864 TTTTTCTTTTTTAGTAGAGAAGG - Intergenic
943431318 2:187805363-187805385 CTTTTCTCCCTTAGTTCAAGTGG - Intergenic
943456457 2:188113838-188113860 CCTTTCTTCTCTAAAACAAAGGG - Intergenic
943601719 2:189929556-189929578 CTTTTTTTTTTTAATAGAAAAGG + Intronic
943947056 2:194080287-194080309 TTTTTTTTTTTTAGTACAGACGG + Intergenic
944986037 2:205178133-205178155 TTTTTTTTTTTTAGTACAGATGG - Intronic
945109663 2:206350178-206350200 CTGTTCTTTTTTAATACATAAGG + Intergenic
945281697 2:208041566-208041588 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
945559643 2:211323200-211323222 TATTTCTTCTTTATTTCAAAAGG - Intergenic
945645806 2:212491452-212491474 CTTTCCTTTTATGGTACAAAGGG - Intronic
945748324 2:213746800-213746822 CTTTTCTTCTTTTTTTGAAATGG - Intronic
946218814 2:218208389-218208411 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
946671351 2:222108209-222108231 CTTTTCTTCATTTCCACAAATGG - Intergenic
946931725 2:224677754-224677776 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
946937039 2:224733129-224733151 CTTTTTTTCTTTAATGCAGAGGG + Intergenic
947041728 2:225929466-225929488 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
947725033 2:232392442-232392464 TTTTTTTTTTTTAGTAAAAATGG - Intergenic
948102722 2:235388222-235388244 CTTTTCTTCCCTAGGTCAAAAGG + Intergenic
948234980 2:236380629-236380651 CCTTTCTTCTTTGGAAAAAAAGG + Exonic
948545607 2:238726580-238726602 CTTTTCTTTTTTTGTAGAGATGG + Intergenic
948796441 2:240404803-240404825 CTTTTCTTTTTTCGTAGAGATGG - Intergenic
1169206557 20:3743865-3743887 CTTTTCCTTTTTACTAAAAAAGG - Intronic
1170138153 20:13098605-13098627 CTATTTTTCATGAGTACAAAGGG - Intronic
1170690333 20:18609320-18609342 ATTTTTTTTTTTAGTAGAAATGG + Intronic
1170693005 20:18631906-18631928 CTCTTCTTGTTTAGGTCAAAGGG + Intronic
1170734707 20:19004820-19004842 TTTTTTTTCTTTAGTAGAATTGG + Intergenic
1170853178 20:20022485-20022507 CTTTTTTTTTTTTGTAAAAAAGG - Intronic
1171010613 20:21507441-21507463 CTATTTTTGTTTAGTACATATGG + Intergenic
1171345060 20:24459729-24459751 CCTTTCTTCTTCAGCAAAAAAGG + Intergenic
1171529586 20:25844013-25844035 GTTTTCTTCTTTAGTAGAGACGG - Intronic
1171547240 20:26011867-26011889 GTTTTCTTCTTTAGTAGAGACGG + Intergenic
1172076898 20:32305752-32305774 TTTTTTTTTTTTAGTACAGATGG + Intronic
1172477487 20:35249763-35249785 TTTTTATTTTTTAGTACAGACGG + Intronic
1172533182 20:35648258-35648280 CTTTCCTTTTTTATTAAAAATGG - Intronic
1172684519 20:36744072-36744094 CTGTTATTTTTTAGTACAGACGG + Intronic
1173018816 20:39249971-39249993 CTTTTCTTCTTTAGCAGATATGG + Intergenic
1173081942 20:39876774-39876796 CTCCTCTTGTTTAGTACATAAGG + Intergenic
1173575476 20:44110599-44110621 ATTTTCTTTTTTAGTAGAGATGG + Intergenic
1174009867 20:47440999-47441021 CTTTTTTTTTTTTGTAGAAACGG + Intergenic
1174236614 20:49098658-49098680 TTTTCCTTCTTCAGTTCAAAAGG + Intergenic
1174526893 20:51179564-51179586 CTTTTGTATTTTAATACAAAAGG - Intergenic
1174546236 20:51327329-51327351 CATTTCTTCCTTTGTATAAATGG + Intergenic
1174608106 20:51776029-51776051 CTTTTATTTTTTTGTACAGACGG - Intergenic
1174972355 20:55290379-55290401 TTTTTTTTTTTTAGTACAGATGG + Intergenic
1175053875 20:56179742-56179764 TTTTTTTTTTTTAGTACAGATGG + Intergenic
1175227510 20:57453253-57453275 TTTTTCTTTTTTTGTAGAAACGG - Intergenic
1175579666 20:60088583-60088605 CATTTCTTCTTTAGTTCTAGAGG + Intergenic
1176545873 21:8198466-8198488 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
1176564824 21:8381511-8381533 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
1177015669 21:15783783-15783805 TTTTTTTTTTTTAGTACAGACGG - Intronic
1177571811 21:22896743-22896765 CGTTTCTTTTTTAGTTGAAATGG + Intergenic
1177586433 21:23101974-23101996 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1177624078 21:23636370-23636392 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1177654473 21:23999872-23999894 TTTTTTTTTTTTTGTACAAATGG - Intergenic
1177917842 21:27113012-27113034 CATTTCTTCTTTATTAAAGAAGG + Intergenic
1178018611 21:28381885-28381907 CTTTTCAGCTCTTGTACAAATGG - Intergenic
1178065547 21:28901052-28901074 CTTTTTTTTTTTAGTAGAGACGG - Intergenic
1178068173 21:28930502-28930524 CTTTTCTTTTTCAGTACAAATGG - Exonic
1178342235 21:31795671-31795693 TTTTTCTGTTTTAGTAGAAATGG + Intergenic
1178477607 21:32951000-32951022 CTTTTCCTCTTTTGGACAGAAGG - Intergenic
1178932140 21:36828501-36828523 CTATTCTTCTTTTGGAAAAAAGG - Intronic
1179023732 21:37661798-37661820 ATTTTTTTTTTTAGTACAGACGG + Intronic
1180973510 22:19830435-19830457 TTTATCTTCTTTGGTATAAATGG - Intronic
1181297759 22:21854652-21854674 CTTTCTTTCTTTCGTCCAAAGGG - Intronic
1181814267 22:25425757-25425779 GTTTTCTTCTTTAGTGGACATGG + Intergenic
1181832131 22:25568995-25569017 GTTTTCTTCTTTAGTGGACATGG + Intronic
1182034583 22:27187840-27187862 ATTTTTTTTTTTAGTAGAAACGG + Intergenic
1182285127 22:29242098-29242120 TTTTTCATTTTTAGTAGAAATGG + Intronic
1182410302 22:30179856-30179878 CTTTACTACTTTACTACTAAAGG - Intergenic
1182564696 22:31188945-31188967 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1183454732 22:37916335-37916357 CTTTTCTTTTTTATTACAAAAGG - Intronic
1184023762 22:41838560-41838582 TTTTGCATCTTTAGTAGAAATGG - Intronic
1184981393 22:48098052-48098074 GTTTTCTTCTTTAGTTCACATGG - Intergenic
1203250744 22_KI270733v1_random:114703-114725 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
949122111 3:398821-398843 CTTTCCTTCTTTATTTAAAAAGG - Intronic
949169674 3:983629-983651 CTTTCTTTCTGTAGTACATAGGG + Intergenic
949745518 3:7287534-7287556 CTATGCTTCTTAAGTACAACAGG - Intronic
950070964 3:10152195-10152217 CTTGTATTTTTTAGTAGAAATGG - Exonic
950073703 3:10172196-10172218 ATTTTTTTTTTTAGTAGAAACGG - Intronic
950796287 3:15513037-15513059 CCTTTCTTCTTTAGTAAAATAGG + Intronic
950977311 3:17261691-17261713 CTTTTATTGTTTTGTACAGATGG + Intronic
951204882 3:19915747-19915769 TTTTTTTTTTTTAGTAGAAATGG - Intronic
951225264 3:20113530-20113552 CTTTTCTTCTCTATTACTAATGG + Intronic
952040229 3:29252501-29252523 TTTTTTTTCTTTAGTAGAGATGG - Intergenic
952062641 3:29528912-29528934 TTTTTCTTTTTTAGTAGAGATGG + Intronic
952299328 3:32090020-32090042 CTTTTCTTTTTTTACACAAAAGG - Intergenic
952385855 3:32841072-32841094 TTTTTGTTTTTTAGTACAGATGG - Intronic
952445828 3:33379876-33379898 TTTTTCTTCTTTAGTTAATATGG - Intronic
952936758 3:38404644-38404666 TTTTTCTTTTTTAGTAGAGATGG - Intronic
954040455 3:47882979-47883001 CTTTTTATCTTTAGTAGAGATGG + Intronic
954310653 3:49764209-49764231 TTTTTTTTCTTTTGTAGAAATGG - Intronic
954343432 3:49974542-49974564 CTTGTATTTTTTAGTAGAAACGG + Intronic
954353653 3:50066655-50066677 TTTTTGTATTTTAGTACAAAGGG - Intronic
954616791 3:51973220-51973242 TTTTTTTTTTTTAGTACAGACGG + Intronic
954720921 3:52562147-52562169 ATTTTTTTTTTTAGTAGAAACGG - Intronic
954721490 3:52567817-52567839 TTTTTTTTTTTTAGTAGAAATGG + Intronic
954884173 3:53857455-53857477 TTTTTCATCTTTAGTAGAGACGG + Intronic
955017784 3:55088786-55088808 TTTTTTTTCTTAAGTACAATGGG - Intergenic
955174201 3:56596928-56596950 TTTTTTTTTTTTAGTACAGATGG + Intronic
955177550 3:56631752-56631774 TTTTTGTACTTTAGTACAGACGG + Intronic
955387280 3:58489852-58489874 CTATTCTTCTTTACTATGAATGG - Intergenic
955709911 3:61767796-61767818 TTTTTTTCCTTTGGTACAAACGG - Intronic
956075047 3:65496209-65496231 TTTTTTTTTTTTTGTACAAATGG + Intronic
956134830 3:66088490-66088512 ATTTTTTTTTTTAGTAGAAATGG + Intergenic
956179290 3:66501883-66501905 TTTTTCATTTTTAGTACAGACGG - Intergenic
956295504 3:67708754-67708776 TTTTTGTTCTTCAGTACATAGGG - Intergenic
956357299 3:68408160-68408182 CATTTCCACTTTATTACAAACGG - Intronic
956423219 3:69106876-69106898 TTTTTTTTTTTTAGTAGAAATGG + Exonic
956502950 3:69907159-69907181 CTTTCATTCTTTAGTACCAAAGG - Intronic
956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG + Intergenic
957117028 3:76039420-76039442 GTTTTCTTGTTTAATATAAATGG + Intronic
957174657 3:76790916-76790938 ATTTTCTTCTTTAGTTAAATGGG + Intronic
957796093 3:85009693-85009715 TTTTTCTATTTTAGTAGAAACGG - Intronic
958410634 3:93811086-93811108 TTTTTCATTTTTAGTAGAAACGG - Intergenic
959131560 3:102362739-102362761 ATTTTCTTCTTTTTTAAAAATGG + Intronic
959163908 3:102753147-102753169 ATTTTCTTCTATAATAAAAAAGG - Intergenic
959426808 3:106200087-106200109 ATTTTTTTTTTTAGTAGAAATGG - Intergenic
959800837 3:110494000-110494022 CTTTTCTCCAGTAGTACAAAGGG + Intergenic
960504904 3:118480371-118480393 ATTTTCCTCTTTAGAACATAAGG - Intergenic
960620426 3:119631798-119631820 AATTTTTTCTTTACTACAAAGGG + Intergenic
960799963 3:121528511-121528533 TTTTTTGTATTTAGTACAAACGG + Intronic
961089340 3:124096211-124096233 CTTTCCTTCATTCGTAAAAAGGG + Intronic
962127467 3:132636020-132636042 CTTTTCTTTTTTAATACAATTGG + Intronic
962197324 3:133375646-133375668 CCTCTCTTCTTTGGCACAAAAGG - Intronic
962218032 3:133539507-133539529 TTTTTGTATTTTAGTACAAAAGG - Intergenic
962334898 3:134519302-134519324 TTTTTTTTCTTAAGTAGAAATGG + Intronic
962877307 3:139545218-139545240 CTTTCCTTGTTTAGTACAGGAGG - Intergenic
963124432 3:141802180-141802202 TTTTTTTTCTTTGGTACAGACGG - Intronic
963166508 3:142209952-142209974 TTTTTTTTTTTTAGAACAAAAGG + Intronic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963636117 3:147798718-147798740 CTTCTCTTCTTTAGTATGAGTGG + Intergenic
963643809 3:147889110-147889132 CTTTTTTTTTTTAGTAGAGACGG + Intergenic
964014680 3:151930393-151930415 TTTTTCTTTTTTAGTAGAAATGG + Intergenic
964607695 3:158574495-158574517 TTTTTTTTTTTTAGTACAGATGG - Intronic
965237136 3:166138593-166138615 TTTTTTTTTTTTAGTACAGACGG + Intergenic
965248632 3:166310568-166310590 CTTTATTTCTTTAGAACTAATGG + Intergenic
965292172 3:166897401-166897423 TTTTTTTTTTTTAGTACAGACGG + Intergenic
965295821 3:166944337-166944359 CTTTTCTTATTTATAAAAAAAGG + Intergenic
965666190 3:171096123-171096145 CTTTTCTTATTTATCAGAAAGGG + Intronic
965917855 3:173872883-173872905 TTTTTGTTCTTTATTACATAAGG + Intronic
966805302 3:183803018-183803040 CTTTGCTTCTTTGGTAGAGAAGG - Intronic
966838747 3:184070362-184070384 CTTTTCTTTTTTGGTATAATTGG + Intergenic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
968294690 3:197566642-197566664 TGATTTTTCTTTAGTACAAACGG + Intronic
968675406 4:1875728-1875750 TTTTTTTTTTTTAGTAGAAACGG - Intronic
968846388 4:3044501-3044523 TTTTTTTTTTTTAGTACAGATGG + Intergenic
968931698 4:3583040-3583062 CTTTTTTTCCTTATTAGAAATGG + Intronic
970061317 4:12037748-12037770 CTTTTCTTCTTAAATAGAGATGG + Intergenic
970814896 4:20143650-20143672 CTTTTCTTCTTTATTAGTATTGG - Intergenic
971234391 4:24828269-24828291 CTTTTTTTTTTTTTTACAAACGG - Intronic
971276982 4:25207837-25207859 CCTCTCTTTTTTAATACAAAAGG + Intronic
971839000 4:31808544-31808566 CTTTTTATTTTTAGTAAAAATGG - Intergenic
972053112 4:34764984-34765006 CTGTCCTTCTTTAGTGCAAGAGG - Intergenic
972143687 4:35994608-35994630 TTTTTTTTCTTTAGTAGAGATGG + Intronic
972149569 4:36071991-36072013 CTTTTCATTTTTAAAACAAAGGG + Intronic
972384547 4:38552178-38552200 TTTTGCTTCTTTAGTAGAGATGG - Intergenic
972600372 4:40566737-40566759 AGTTTCTTCATTTGTACAAAGGG + Intronic
972621681 4:40753120-40753142 CTTTTCTTATTGAGTACTAAAGG - Intronic
972655766 4:41062347-41062369 ATTTTTTTTTTTAGTAGAAATGG + Intronic
972684176 4:41335795-41335817 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
972819784 4:42687363-42687385 CTTTTGTATTTTAGTACAGACGG - Intergenic
972893487 4:43589335-43589357 CTTTTTCTCTTTTGTACAAATGG - Intergenic
972975298 4:44626952-44626974 TTTTTTTTTTTTAGTACAGACGG + Intronic
973150137 4:46877409-46877431 CTTTTCTTCTTTGGTATAGGAGG + Intronic
973212632 4:47633867-47633889 CTCTTCTTCTTGAGTATAACAGG + Intronic
973302705 4:48606083-48606105 TTTTTTTTCTTTAGTAGAGACGG - Intronic
973749613 4:54001093-54001115 TTTTTGTTTTTTAGTACAGACGG + Intronic
973813309 4:54594534-54594556 TTTTTTTTTTTTAGTAAAAATGG - Intergenic
973889677 4:55356645-55356667 CTTTTCTTTTTTAGTAGAGATGG + Intronic
974097722 4:57383284-57383306 CTTTTCTTCTAAACTTCAAATGG - Intergenic
974981452 4:68962358-68962380 TTTTTTTTCTTCAGTAAAAATGG + Intergenic
975084196 4:70317890-70317912 GTTTTCTTCTTTAATAATAATGG - Intergenic
975163602 4:71151746-71151768 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
975294880 4:72722572-72722594 TTTTTCTACCTTAGCACAAAAGG + Intergenic
975444693 4:74449033-74449055 CTTTTCTTTTTTAGTTGAACAGG + Exonic
975453801 4:74565188-74565210 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
975734197 4:77365964-77365986 TTTTTTTTTTTTAGTACAGATGG + Intronic
976082302 4:81369019-81369041 TTTTTCTTTTTTTGTAGAAATGG - Intergenic
976228209 4:82813555-82813577 CTTTTCTATTTTAGTAGAGATGG - Intergenic
976944335 4:90745870-90745892 TTTTTTTTCTTTAGTAGAGACGG + Intronic
977155306 4:93565532-93565554 CTTTTATTTTTTAATACAATAGG - Intronic
977407456 4:96618036-96618058 CTTTTCTTTTTAATCACAAAGGG + Intergenic
977612096 4:99046389-99046411 CTTTTCTTCTTTTTTTGAAATGG - Intronic
978382978 4:108149977-108149999 CTTTTCTTCTTTTTCTCAAAAGG - Intronic
978429202 4:108616169-108616191 TTTTTTTTTTTTAGTACAGACGG - Intergenic
978478312 4:109158029-109158051 TTTTTTTTCTTTAGTTCAACAGG - Intronic
978595834 4:110376041-110376063 ATTTTGTTCTTTAGTAGAGATGG + Intronic
978700854 4:111644239-111644261 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
978894026 4:113864298-113864320 AGTTTCTTCTTTAGTAAAAAGGG + Intergenic
979009267 4:115345948-115345970 CTTTTTTTCTTTTGTACGGAAGG + Intergenic
979465396 4:121031843-121031865 GTTTTCTTCTGTAGCATAAAGGG + Intergenic
979508328 4:121523556-121523578 TTTTTCTTTTTAAGTACAAAAGG - Intergenic
980200166 4:129646472-129646494 CGTTTCTTTCTTAGTACAATAGG + Intergenic
980262568 4:130471199-130471221 GTTTTCTTCTTTATTATAACTGG - Intergenic
980657613 4:135810649-135810671 CTTTTTGACTTTAGTAAAAACGG + Intergenic
980924012 4:139116012-139116034 CTTGTATTTTTTAGTACAGATGG + Intronic
981495119 4:145382565-145382587 CTTTACTTCTTTAAGACAAGAGG - Intergenic
982488523 4:155999183-155999205 TTTTTCTTTTTTAGTAGAGACGG + Intergenic
982584571 4:157221309-157221331 CTTTTCTTCTATTGTATCAAAGG - Intronic
983051189 4:163049363-163049385 CATTTTTTCTTTAGGAAAAAGGG - Intergenic
983675046 4:170282284-170282306 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
983883087 4:172954777-172954799 TTTTTCTTTTTTAACACAAATGG + Intronic
984079226 4:175223146-175223168 CTTTTCTTCATTAAGACACATGG + Intergenic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
984215034 4:176901326-176901348 TTTTTTTTCTTTAGTAGAGACGG - Intergenic
984481063 4:180302501-180302523 ATTTTTTTTTTTAGTAGAAATGG - Intergenic
984676351 4:182552274-182552296 CTTTTTTTCTTTTGTAGAGATGG - Intronic
984753591 4:183302891-183302913 TTTTACATCTTTAGTAGAAACGG - Intronic
984800492 4:183711389-183711411 CTTTTCTTCCTTTGAATAAAAGG + Intronic
985245220 4:187973757-187973779 CTTTTCTTCCCTTGTAGAAATGG + Intergenic
985996190 5:3598506-3598528 ATTTTTTTTTTTAATACAAAAGG - Intronic
986415886 5:7527577-7527599 CTTTGCTTCTTTAATAAATATGG - Intronic
986597088 5:9435020-9435042 TTTTTCTTTTTTATTACAAACGG - Intronic
986880665 5:12166340-12166362 CTTTCCTTTTTTAGTAGAGACGG - Intergenic
987040656 5:14059129-14059151 ATTTTTTTCCTTAGTAGAAATGG - Intergenic
987227967 5:15863342-15863364 TTTTTCTTCTTAAATAAAAATGG - Intronic
987352894 5:17036869-17036891 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
987689807 5:21252119-21252141 ATTTTTTTTTTTAGTACAGATGG + Intergenic
988035279 5:25820094-25820116 TTTTTCTAGATTAGTACAAAAGG + Intergenic
988438444 5:31204246-31204268 TTTTTCTTCTTGAGTTTAAATGG + Intronic
989273928 5:39565024-39565046 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
989475272 5:41867885-41867907 CTTTTCTTCATTATTACTGAGGG - Intronic
989505207 5:42218644-42218666 CTTTTCTTCTTTCAAACATATGG - Intergenic
990071040 5:51783349-51783371 TTTTTCTTTTTTAGTAGAGATGG + Intergenic
991450569 5:66746478-66746500 CTTTTCCTCTTTGGTAAAATGGG + Intronic
992053763 5:72966797-72966819 TTATTCTTCTTTAGTGAAAATGG - Intronic
992333065 5:75737578-75737600 CTTTTCTTTTTTTGTAGAGATGG + Intergenic
992840077 5:80680080-80680102 TTTTTTTTTTTTAGTAGAAACGG - Intronic
993294234 5:86114230-86114252 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
993641023 5:90405799-90405821 CTTTTCCTTTTTAATCCAAAAGG - Exonic
994164767 5:96597276-96597298 CTTTTCTTTTTTAGGGCAGATGG - Intronic
994282601 5:97923552-97923574 TTTTTTTTCTTTAGTGAAAATGG + Intergenic
994307680 5:98226941-98226963 ATTTTCTTTTTTTCTACAAAGGG - Intergenic
994664929 5:102694854-102694876 CTTTTCTACTTTATTAAATATGG + Intergenic
994709569 5:103250439-103250461 CTTTTTTTTTTTTGTAGAAATGG + Intergenic
994987682 5:106958820-106958842 CATTTATTCTTTAGTACAATAGG + Intergenic
995024153 5:107399280-107399302 CCTTCCTTCTTTAGTAGAGATGG - Intronic
995080900 5:108049318-108049340 TTTTTAATCTTTAGTACAGATGG + Intronic
995351602 5:111182385-111182407 TTTTTATTTTTTAGTACAGACGG - Intergenic
995465525 5:112446557-112446579 CTTGCCTTCTTTTCTACAAAAGG - Intergenic
995980317 5:118094556-118094578 TTTTCCTCCTTTAGTAAAAATGG + Intergenic
995989044 5:118213393-118213415 TTTTTTTTTTTTAGTACAGACGG - Intergenic
996279011 5:121704859-121704881 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
997918483 5:137953429-137953451 CTTTTCATCTTTTGAACTAAAGG + Exonic
997932917 5:138086862-138086884 TTTTTGGTCTTTAGTACATATGG - Intronic
998258638 5:140610176-140610198 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
998469599 5:142373236-142373258 TTTTTTTTCTTTTGTAGAAATGG + Intergenic
998514484 5:142740386-142740408 CTTTTCTTCTTCTGTAAAATGGG - Intergenic
998632878 5:143919746-143919768 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
998786924 5:145722134-145722156 ATTTTCCTCTTTAGCACACATGG + Intronic
999015969 5:148105792-148105814 TTTTTTTTTTTTAGTAGAAATGG + Intronic
999965290 5:156802925-156802947 ATTTTCTTCTCTAAAACAAAGGG + Intergenic
1000591892 5:163168291-163168313 CTTTTCTTCTTTATTAGTCAGGG - Intergenic
1000984526 5:167852512-167852534 CGTTTCTTCTTTAGTTAAATAGG - Intronic
1001065791 5:168534176-168534198 CTTTTCTATTTTAGTAGAGATGG - Intergenic
1001196789 5:169680213-169680235 CTTTTCTTCATTTGTAAAATGGG + Intronic
1001208661 5:169789463-169789485 CTTCTTTCCTTTAGTACACATGG + Intronic
1001305374 5:170568638-170568660 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1002775383 6:323977-323999 CTTTTCTTCTTCAGGGCATAGGG - Intronic
1003475188 6:6475232-6475254 CTTTTGTCCTTTAGTCCACAAGG + Intergenic
1004480856 6:16018106-16018128 ATTTTCTTTTTTAGTAGAGATGG - Intergenic
1004803089 6:19172607-19172629 CTTTTCTGCTGTAGTAGCAAAGG + Intergenic
1004909181 6:20266886-20266908 CTTTTCTTCTTTACTAAAATTGG + Intergenic
1004965480 6:20844677-20844699 CTTTTTTTTTTTAATAGAAACGG - Intronic
1005394332 6:25365719-25365741 ATTTTCTTTTTTAGTAGAGATGG + Intronic
1006047655 6:31310800-31310822 CTTTTCTTCTTTATGACACTGGG - Intronic
1006254016 6:32814940-32814962 ATTTTCTGCTTTAGGATAAATGG - Intronic
1006692915 6:35905294-35905316 CTTTTCTTCTTTAGATATAAAGG + Intronic
1006772955 6:36569101-36569123 TTTTTCTTTTTTAGTAGAGACGG + Intergenic
1007534496 6:42573717-42573739 CTTTTCTTCTTTTAAAGAAATGG + Exonic
1007645924 6:43381083-43381105 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1008000706 6:46356855-46356877 CTTTTCTTATTTGGTAGAATGGG - Intronic
1008279455 6:49578652-49578674 ATTTTCTTTTTCAATACAAATGG + Intergenic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1008437372 6:51492155-51492177 CTTTTCTTCTTGAGCCCACAGGG + Intergenic
1008509488 6:52262961-52262983 CTTTGGTTCGTTAGGACAAAGGG - Intergenic
1008516980 6:52327564-52327586 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1008542931 6:52561453-52561475 CTTTTATACTTTAGTAGAGATGG + Intronic
1008585951 6:52949329-52949351 CTTTTCTTCTATGGTTCAGAAGG - Intergenic
1008747781 6:54693698-54693720 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1008911746 6:56741002-56741024 ATTTTCTTCTTGGGTAAAAAAGG + Intronic
1009031519 6:58064265-58064287 CTATTCATCTTTGGTAGAAATGG - Intergenic
1009207365 6:60818718-60818740 CTATTCGTCTTTGGTAGAAATGG - Intergenic
1009316860 6:62230170-62230192 CTTTTCTTCTTTATTACTTTAGG + Intronic
1009435946 6:63618720-63618742 CTTTGTTTCTTTAGTAGAGACGG - Intergenic
1009563709 6:65280845-65280867 ATTTTTTTTTTTAGTACAGACGG - Intronic
1009621491 6:66084031-66084053 CTTTGCTTCTTTATTAAAATGGG + Intergenic
1009925579 6:70116650-70116672 TTTTTTTTCTTGAATACAAAGGG + Intronic
1010429121 6:75758628-75758650 TTTTTCTTATTTAGTAGAGATGG + Intronic
1010612242 6:77967681-77967703 CTTTCCTTCATTGTTACAAAGGG + Intergenic
1010813415 6:80326560-80326582 GTTTTCCTCTTTTGTAGAAAGGG - Intronic
1010856065 6:80841703-80841725 CTTTTCTACTTTTTCACAAAGGG - Intergenic
1012261299 6:97090742-97090764 TTGTTCTCCTGTAGTACAAAAGG + Intronic
1012466602 6:99522608-99522630 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1013210257 6:107980545-107980567 TCTTTCTTCTTAACTACAAAGGG + Intergenic
1013248860 6:108314567-108314589 CTTTTGTGTTTTAGTAGAAACGG + Intronic
1013542050 6:111120873-111120895 TTTTTATTCTTTAGTACTAACGG + Intronic
1014149297 6:118035434-118035456 GTTTTTTTTTTTAGTAGAAATGG - Intronic
1014438465 6:121446657-121446679 CTTTTCTTCGTTGGCAAAAATGG + Intronic
1015679464 6:135788847-135788869 CCTTTCCTGTTTAATACAAATGG + Intergenic
1015863008 6:137700038-137700060 CTTTTTTTCTTTTGTAGAGATGG - Intergenic
1015871122 6:137777418-137777440 TTTTTTTTCTTCAGTACAAACGG - Intergenic
1015934319 6:138393173-138393195 TCTTTCTTCATTGGTACAAATGG - Intergenic
1015996823 6:139003322-139003344 ATTTTCTTCTTCTGTAAAAAGGG + Intergenic
1016109006 6:140197963-140197985 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
1016275802 6:142351061-142351083 ATTTTCTTTTTTAGTAGAGACGG - Intronic
1016632255 6:146247106-146247128 CTCTTCTTCTTCAGTCCACAAGG + Intronic
1016920373 6:149286943-149286965 TTTTTATTTTTTAGTAGAAACGG - Intronic
1017024457 6:150169045-150169067 TTTTTGTACTTTAGTAGAAATGG + Intronic
1017135579 6:151144516-151144538 CTTTTTTTTTTTAGTAGAGACGG + Intergenic
1017956693 6:159184348-159184370 ATTTTTTTCTATATTACAAACGG + Intronic
1018130406 6:160725499-160725521 CTTTCCTTCTTTTGGATAAATGG - Intronic
1018181249 6:161225554-161225576 CTTTTCTTTTCTAGTTCTAAGGG - Intronic
1018435390 6:163754241-163754263 ATTTTTTTTTTTAGTAGAAATGG + Intergenic
1019012783 6:168855559-168855581 TTTGTATTTTTTAGTACAAATGG - Intergenic
1019023227 6:168936622-168936644 CTTATCTTCTTTAGTGTAGATGG + Intergenic
1020072718 7:5238113-5238135 TTTTTCTTTTTTAGTAGAGACGG - Intergenic
1020076038 7:5259639-5259661 TTTGTATTCTTTAGTACAGACGG - Intergenic
1020121026 7:5503528-5503550 CTTTTTTTTTTTTGTACAGATGG + Intronic
1020251090 7:6469122-6469144 TTTTTATTTTTTAGTACAGACGG + Intronic
1020991038 7:15196217-15196239 CTTTTTTTTTTTAGTAGAGAAGG + Intergenic
1021015956 7:15533681-15533703 CTTTTCTTCTTTAGAAATATAGG - Intronic
1021742932 7:23705783-23705805 TTTTTTTTTTTTAGTGCAAATGG + Intergenic
1022125082 7:27348680-27348702 CATTTCTTCATCAGTAGAAATGG + Intergenic
1022613766 7:31906805-31906827 CATTTCTTCTTTGGTAAAATAGG + Intronic
1022706241 7:32804660-32804682 TTTTTTTTTTTTAGTACAGACGG + Intergenic
1022784862 7:33627870-33627892 CTTTTATTTTTTTGTACAGATGG - Intergenic
1023088210 7:36593568-36593590 CCTTTCTTCTTTTTTACACATGG + Intronic
1023598023 7:41853139-41853161 CTTTTCTTCTTTTGTAGATTAGG - Intergenic
1023609772 7:41960990-41961012 TTTTTTTTCTTTGTTACAAAAGG + Exonic
1023774595 7:43592677-43592699 TTTTTTTTTTTTAGTACAGATGG - Intronic
1024301774 7:47892464-47892486 CTTTTACTCTTGAGTAAAAAGGG + Intronic
1024332865 7:48173867-48173889 GTTTTCTTATTTGGTAGAAATGG + Intronic
1024747543 7:52425635-52425657 TTTTTCTTCTTTTCTACAATTGG - Intergenic
1025032131 7:55566380-55566402 TTTTTTTTCTTTAGTAGAGACGG - Intronic
1025195526 7:56929404-56929426 CTTTTTTTTTTTAGTAGAGATGG - Intergenic
1025203045 7:56973922-56973944 TTTGTATTCTTTAGTACAGACGG + Intergenic
1025636749 7:63327284-63327306 TTTTTTTTTTTTAGTAGAAAAGG + Intergenic
1025645947 7:63420818-63420840 TTTTTTTTTTTTAGTAGAAAAGG - Intergenic
1025668899 7:63603004-63603026 TTTGTATTCTTTAGTACAGACGG - Intergenic
1025676426 7:63647535-63647557 CTTTTTTTTTTTAGTAGAGATGG + Intergenic
1025816157 7:64914197-64914219 TTTTTTTTTTTTAGTACAGATGG + Intronic
1025933295 7:66013515-66013537 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1026058232 7:67003870-67003892 TTTGTATTTTTTAGTACAAATGG - Intronic
1026062327 7:67037329-67037351 TTTTTTTTATTTAGTAGAAATGG - Intronic
1026158645 7:67849969-67849991 TTTTTTTTTTTTAGTACAGATGG + Intergenic
1026248688 7:68647531-68647553 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1026370647 7:69695150-69695172 TTTTTCTTTTTTTGTAGAAATGG - Intronic
1026716018 7:72790120-72790142 TTTTTTTTATTTAGTAGAAACGG + Intronic
1026719859 7:72821142-72821164 TTTGTATTTTTTAGTACAAATGG + Intronic
1026818209 7:73528883-73528905 CTTTTGTTTTTTAGTAGAGACGG + Intergenic
1026829524 7:73602498-73602520 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1026910326 7:74087912-74087934 CTTTTCTTTTTTTTTACACAGGG + Intronic
1027424618 7:78049832-78049854 GTTTTCTTATTTAGTTCAGAAGG + Intronic
1027617281 7:80438884-80438906 TTTTTGTTTTTTAGTACAGAAGG - Intronic
1027715341 7:81662425-81662447 CTTTACATCTTTAGTACATTTGG - Intergenic
1028050877 7:86184460-86184482 CTCTACTTCTTTTGTACAACAGG - Intergenic
1028212249 7:88088425-88088447 CATTTCTTCTTTCTTAAAAAAGG + Intronic
1028260645 7:88659967-88659989 CTTTTTTTTTTTTTTACAAAGGG - Intergenic
1028394609 7:90354002-90354024 TTTTTCTTTTTTTGTAGAAATGG + Intronic
1028711819 7:93918106-93918128 CTTTTCTTTTTTAGTAGAGACGG - Intergenic
1028783869 7:94769626-94769648 CTGTTTTTCTTTTATACAAAAGG - Intergenic
1028801593 7:94971410-94971432 CTTTTTTTCTTTATTACCCATGG + Intronic
1028991981 7:97058707-97058729 TTTTGCATTTTTAGTACAAACGG - Intergenic
1029043897 7:97606875-97606897 CTTTTCTTATTTACTACTAAAGG + Intergenic
1029848992 7:103443210-103443232 CTTTTCTTCTTCTATACATAGGG - Exonic
1030226616 7:107158789-107158811 CTTTTTATCTTTAGTGTAAAAGG + Intronic
1030406976 7:109127450-109127472 TTTTTCTTTTTTTTTACAAAAGG + Intergenic
1030504332 7:110400250-110400272 CTTTTTATTTTTAGTACAGATGG + Intergenic
1030686862 7:112496073-112496095 CTTTCCTTCTTTCTTTCAAATGG - Intergenic
1030768810 7:113446976-113446998 GTTTTCTTCTGAAGTATAAATGG + Intergenic
1030984658 7:116227292-116227314 TTTTTTTTTTTTAGTAGAAACGG + Intronic
1031136445 7:117889509-117889531 CTTTTATTCTGTTGTATAAAAGG - Intergenic
1031431319 7:121673669-121673691 CTTTTTATCGTTAGTATAAATGG + Intergenic
1031539993 7:122983345-122983367 CTTTTTGTCTTTCCTACAAAAGG + Intergenic
1031898652 7:127384978-127385000 CTTTTCATCTGTAGTACTCATGG - Intronic
1032105495 7:129025576-129025598 CTTTTCTTTTTTTATAAAAATGG + Intronic
1032137250 7:129291135-129291157 CTTTTCTCTTTTAATATAAATGG + Intronic
1032157604 7:129481861-129481883 CTTTTGTTTTTTAACACAAATGG - Intronic
1033198613 7:139348988-139349010 TTTTGCATTTTTAGTACAAACGG - Intronic
1033198985 7:139352187-139352209 CTTTTCTTCTTTTTTAGAGATGG - Intronic
1033575351 7:142677393-142677415 TTTTTCTTTTTTAGTAGAGACGG + Intergenic
1033674653 7:143528345-143528367 CTTTGTATCTTTAGTAAAAACGG - Intergenic
1033697183 7:143801095-143801117 CTTTGTATCTTTAGTAAAAACGG + Intergenic
1033836399 7:145317471-145317493 CTTTTATTCTTTTTTACAATGGG + Intergenic
1034130265 7:148709910-148709932 CTTTTCATTTTTTGTACAGATGG - Intronic
1034651504 7:152694510-152694532 CATTTTTGCTTTAATACAAAAGG - Intergenic
1034660453 7:152764459-152764481 CTTTTTTTTTTTAGTAGAGACGG - Intronic
1034781381 7:153885992-153886014 CTCTTATTCTTTTTTACAAACGG + Intergenic
1035203021 7:157278924-157278946 CTTTTCTTTTTTTGTAGAGACGG + Intergenic
1035976023 8:4312704-4312726 CATTTTTTCGTTAGTAGAAATGG - Intronic
1037105416 8:15101011-15101033 CATTTGTTTTTTATTACAAATGG - Intronic
1037304626 8:17492570-17492592 ATTTTTTTCTTTTGTAGAAAAGG + Intergenic
1037416464 8:18656060-18656082 CTTTTCTTCTTTTTTTCAGACGG + Intronic
1037537265 8:19836208-19836230 TTTTTCTTCTTTTATGCAAAAGG - Intronic
1038312360 8:26454307-26454329 TTTTTCTTCTTTTGTAGAGACGG + Intronic
1038568003 8:28635889-28635911 CTTTTCTTTTTTAATAGAGATGG + Intronic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1038835266 8:31113487-31113509 CTTTTCCTCTTTAGGATGAAAGG - Intronic
1039147526 8:34465523-34465545 TTTTTGTTCTTTAGTAGAGACGG + Intergenic
1039950959 8:42172374-42172396 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1039975448 8:42360125-42360147 TTTTTTTTTTTTAGTAGAAAAGG + Intronic
1040448469 8:47520652-47520674 CTTTTCATCCTTAACACAAATGG + Intronic
1040525522 8:48220594-48220616 CTTTTTTTTTTTTGTAGAAATGG + Intergenic
1040589083 8:48772922-48772944 TTTTTTTTTTTTAGTACAGACGG - Intergenic
1040959002 8:53011130-53011152 TTTTTCTTTTTTAGTAGAGACGG + Intergenic
1041089802 8:54291538-54291560 ATTTTTTTTTTTAGTAGAAACGG - Intergenic
1043136531 8:76533923-76533945 TTTGTGTTCTTTATTACAAATGG - Intergenic
1043234360 8:77843027-77843049 CTTTTCTATTTTAGTAGAGATGG + Intergenic
1043552479 8:81390253-81390275 CTGTTCTTCCTTAAAACAAATGG - Intergenic
1044528317 8:93277606-93277628 CTTTTCTTCTTTAGTCTTTAAGG + Intergenic
1044720987 8:95146204-95146226 GTTTTCTTCTTTAAAAAAAAAGG + Intronic
1045599791 8:103699691-103699713 CTTTTCTTCTTTTGTAAATTAGG + Intronic
1045811107 8:106221000-106221022 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1046219505 8:111194684-111194706 CTATTCTTATTTACTGCAAAGGG + Intergenic
1046342106 8:112872666-112872688 CTTTTCATCCTTAATACTAATGG - Intronic
1046433690 8:114160758-114160780 TTTTTTTTTTTTAGTACAGACGG + Intergenic
1046545816 8:115648635-115648657 TTTTTCTTCTTAAAAACAAAAGG + Intronic
1046617376 8:116491821-116491843 AATCTCTTCTTTAGTCCAAAAGG - Intergenic
1046710822 8:117509568-117509590 TTTTTCTTCTTGATGACAAATGG - Intergenic
1046902558 8:119538856-119538878 CTTTTCTTATTTTGTTCAATAGG + Intergenic
1047021395 8:120778478-120778500 CTTTTCATTTTCAGAACAAAAGG + Intronic
1047401445 8:124551851-124551873 CTTTTCTTCTTTCAAATAAATGG - Intronic
1047839034 8:128727751-128727773 CTTTCCTTCTCTGGTCCAAATGG + Intergenic
1048964816 8:139607883-139607905 CTTTTCATCTTTTGTAGGAAAGG + Intronic
1049856619 8:144866139-144866161 TTTTTTTTTTTTAGTACAGACGG + Intergenic
1050279338 9:4034049-4034071 CTTTTTTTTTTTAATAGAAATGG - Intronic
1050327329 9:4510002-4510024 TTTTTCATTTTTAGTAGAAATGG + Intronic
1050420333 9:5457680-5457702 CTTTACTTTTTTATTACAAATGG + Intronic
1050901363 9:10952937-10952959 TTTTACATCTTAAGTACAAATGG - Intergenic
1050945073 9:11506976-11506998 CTTTTTTTCTTTAATAGAAATGG + Intergenic
1050993841 9:12188220-12188242 TTTTTTTTCTTTAGAAAAAATGG - Intergenic
1051160006 9:14197039-14197061 TTTATCATATTTAGTACAAATGG - Intronic
1051671548 9:19515573-19515595 CTTTACCTCTTAAGTACAAGAGG - Exonic
1051744341 9:20280535-20280557 GTTTTCCTCTTTAGTAACAATGG - Intergenic
1051757986 9:20425838-20425860 CTTAAATTCTTTAGAACAAAAGG - Intronic
1051829536 9:21259820-21259842 CTTTTATTCTTTATAACAAGAGG - Intergenic
1052400898 9:27998606-27998628 TTTTTCATTTTTAGTAGAAACGG - Intronic
1052548169 9:29907599-29907621 TATTTCTTCTTAAGTAGAAATGG + Intergenic
1052637622 9:31123979-31124001 CTTTTCTTCATGAATACAACTGG + Intergenic
1052677682 9:31648162-31648184 TTTTTTTTTTTTAGTAGAAACGG + Intergenic
1052871494 9:33511719-33511741 CTTTTTTTTTTTTATACAAACGG - Intergenic
1053090757 9:35274241-35274263 CTTTTCTTTTTTTGTAGAAATGG + Intronic
1053210809 9:36226062-36226084 CTTTTCTTCTTGATTTCAATGGG + Intronic
1053518323 9:38751729-38751751 GTTTTCTTCTTTACTAAATATGG + Intergenic
1053522666 9:38796833-38796855 TTTTTTTTTTTTAGTACAGACGG + Intergenic
1053523187 9:38802807-38802829 CTTGTATTCTTTAGTAGAGACGG + Intergenic
1053797563 9:41740311-41740333 GTTTTCTTTTTTAGTAGAGATGG - Intergenic
1054185975 9:61952363-61952385 GTTTTCTTTTTTAGTAGAGATGG - Intergenic
1054195413 9:62027225-62027247 CTTGTATTCTTTAGTAGAGACGG + Intergenic
1054278779 9:63112805-63112827 GTTTTCTTCTCTGGTACATAAGG - Intergenic
1054467373 9:65505679-65505701 GTTTTCTTTTTTAGTAGAGATGG + Intergenic
1054499679 9:65864194-65864216 GTTTTCTTCTCTGGTACATAAGG - Intergenic
1054642994 9:67561464-67561486 CTTGTATTCTTTAGTAGAGACGG - Intergenic
1054652528 9:67636157-67636179 GTTTTCTTTTTTAGTAGAGACGG + Intergenic
1055364390 9:75527451-75527473 CTTACCTTCTTTAGTACAGAGGG + Intergenic
1055481068 9:76709726-76709748 CTTTTCTTCTTCAGAACTACTGG - Exonic
1055489378 9:76789310-76789332 CATTTCTTCTTTTGTAAAATGGG - Intronic
1055684650 9:78758391-78758413 CTTTGCTTCTTTGGTCCACATGG - Intergenic
1055926556 9:81516079-81516101 CTTTGCTTGTTTAGAACAATAGG - Intergenic
1056279903 9:85030986-85031008 CTTTTCTCCTATAGTAGATATGG + Intergenic
1056343950 9:85671116-85671138 CTTTTTTTTTTTTGTAGAAATGG + Intronic
1056596707 9:88013673-88013695 TTTTTCTTTTTTAGTAGAGATGG - Intergenic
1057427949 9:94969100-94969122 CTTATCTACTTTGTTACAAATGG + Intronic
1057433381 9:95016411-95016433 TTTTTGTTTTTTAGTAGAAATGG + Intronic
1057645663 9:96873165-96873187 CTTTAATTCTTTAGTACCTAAGG + Intronic
1057754873 9:97825141-97825163 CTTTTTTTCTTTGGTAGAGATGG - Intergenic
1057897144 9:98918114-98918136 CTTTTCTCCTTTTGTAAAATGGG - Intergenic
1057974324 9:99588173-99588195 CTTTGCTTCTGTAGTCCACAAGG + Intergenic
1058088325 9:100775295-100775317 CTTTTCTTCCTGACTACAAATGG + Intergenic
1058130736 9:101250081-101250103 CATTTCTACGTTAGTACCAAAGG + Intronic
1058308807 9:103475271-103475293 TTTTTCTTTTTTAGTAGAGATGG + Intergenic
1058674479 9:107388755-107388777 TTTTGCATCTTTAGTAGAAACGG - Intergenic
1059010643 9:110455265-110455287 TGTTTCTTCATTAGTAAAAATGG - Intronic
1059218862 9:112592953-112592975 CTTTTTTTCTTTCATAAAAATGG - Intronic
1059614011 9:115929535-115929557 TTTTTTTTCTTTAGTAGAGATGG + Intergenic
1059879342 9:118672770-118672792 TTTTTCTTTTTTAGTAGAGACGG + Intergenic
1060160411 9:121357606-121357628 CTTTTTGTATTTAGTACAGATGG + Intronic
1060203545 9:121667666-121667688 CTTTTTTTTTTTAATACAGATGG + Intronic
1060237520 9:121876232-121876254 CTTTTCTTCTTATGTATAAGTGG + Intronic
1060384508 9:123212045-123212067 CTTTTCTTATTCAGAGCAAAAGG - Intronic
1060453607 9:123767398-123767420 TTTTTTTTCTTTTTTACAAAAGG - Intronic
1060977357 9:127772566-127772588 CTTTTTTTCTTTATTTCAACAGG + Intronic
1061958483 9:133976023-133976045 CTTTTTTTTTTTAGTAGAGATGG - Intronic
1062516306 9:136938413-136938435 TTTTTTTTTTTAAGTACAAAAGG + Intronic
1203467145 Un_GL000220v1:97971-97993 CTTTTCTTTTTCAGTAGAGACGG + Intergenic
1185665940 X:1765700-1765722 TTTTTCTTCTTTTGTAGAGACGG - Intergenic
1186073873 X:5854781-5854803 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1186764146 X:12753836-12753858 CTTTTTTTTTTTTTTACAAAGGG + Intergenic
1186947874 X:14589485-14589507 TTTTTTTTTTTTAGTACAGATGG - Intronic
1187329794 X:18327197-18327219 TTTTTTTTTTTTAGTAGAAACGG - Intronic
1187330066 X:18329771-18329793 TTTTTCTTCTTTATAACACAGGG - Intronic
1187613712 X:20970856-20970878 CTTTTCTTTTTTTGTAGAGATGG + Intergenic
1187899152 X:24011203-24011225 CTTTTCTTATTTATTAACAAGGG - Intronic
1187973507 X:24682312-24682334 CTTTTGTACTTTAGTAGAGACGG + Intergenic
1188060834 X:25599575-25599597 TTTTTCTTCTTTATTAAAATTGG + Intergenic
1188565253 X:31519959-31519981 CTTTTCTTCTCTTATACAATAGG + Intronic
1188843783 X:35048161-35048183 ATTTTCTTCGTTAGTGAAAATGG + Intergenic
1188858832 X:35231622-35231644 CTTTTCTTCTTATGTTCAAAGGG - Intergenic
1188922875 X:36000331-36000353 CCTTTGTTTTTTATTACAAATGG - Intergenic
1189048204 X:37615959-37615981 ATTTTCCACTTTTGTACAAAAGG + Intronic
1190580883 X:51892675-51892697 CTTTGCTTGTTTGGTACAAATGG + Intronic
1191082817 X:56531718-56531740 CTTTTCTATTTTAGTACAGACGG + Intergenic
1191882143 X:65853527-65853549 CTTTTCTTCTTTATTAGTAGTGG + Intergenic
1191959056 X:66679502-66679524 GTTTTCCTCATTAGTAAAAAGGG - Intergenic
1192026632 X:67459700-67459722 CTTTTCTTCTTTATTACTCTAGG - Intergenic
1192744447 X:73925062-73925084 TTTTTTTTTTTTAGTAGAAATGG + Intergenic
1193377670 X:80781133-80781155 TTTTTTATCTTTAGTACAATTGG - Intronic
1193909443 X:87283830-87283852 CTTTCCTTCTTTGGTAAACATGG + Intergenic
1194678678 X:96825124-96825146 TTTTTTTTTTTTAGTACATATGG + Intronic
1195085051 X:101406030-101406052 TTTTTTTTTTTTAGTACAGACGG - Intronic
1195937021 X:110135227-110135249 CTTTTTTTTTTTAGAAGAAAAGG - Intronic
1195946278 X:110215905-110215927 TTATTCTTCTTTAGTACATGGGG - Intronic
1196586606 X:117436362-117436384 CTTTTCTTCTGTTGTAGAAGAGG - Intergenic
1196776928 X:119347081-119347103 CTTTTCTTCTTTTTTAAAAAAGG - Intergenic
1197290538 X:124651485-124651507 CAGTTCTTCTTTAGAACAACTGG - Intronic
1197337832 X:125229793-125229815 TTTTTCCTTTTAAGTACAAATGG - Intergenic
1197383213 X:125770762-125770784 CTTTTCTTCTTTAGAAGACTCGG - Intergenic
1197851425 X:130864840-130864862 CTTTTGTATTTTAGTAGAAATGG - Intronic
1197999977 X:132423665-132423687 CTTTTTTTCATTAGGAAAAAAGG - Intronic
1198104189 X:133447085-133447107 TTTTTTTTTTTTAGTAGAAATGG - Intergenic
1198252377 X:134892257-134892279 GTTTTCTTCTTTACTATAAATGG - Intronic
1198467341 X:136915455-136915477 ATTTTTTTTTTTAGTACAGATGG + Intergenic
1198764649 X:140068211-140068233 TTTTTTTTTTTTAGTAGAAACGG - Intergenic
1200237460 X:154474967-154474989 TTTTTTTTCTTTAGTAGAGATGG + Intergenic
1200418606 Y:2938179-2938201 TTTTTTTTTTTTAGTAGAAACGG + Intronic
1200550103 Y:4569000-4569022 CTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1201354284 Y:13081710-13081732 TTTTTCTTTTTTAGTAGAAACGG + Intergenic
1201377377 Y:13338197-13338219 TTTTTTTTTTTTAGTAGAAACGG + Intronic
1201535839 Y:15047267-15047289 TTTTTATTTTTTAGTACAGATGG + Intergenic
1202060539 Y:20883196-20883218 CTTTTATTTTTTAGTATTAAAGG + Intergenic
1202245313 Y:22813936-22813958 TTTTTCTTTTTTCCTACAAATGG + Intergenic
1202398303 Y:24447682-24447704 TTTTTCTTTTTTCCTACAAATGG + Intergenic
1202472478 Y:25222404-25222426 TTTTTCTTTTTTCCTACAAATGG - Intergenic