ID: 1070279027

View in Genome Browser
Species Human (GRCh38)
Location 10:75035434-75035456
Sequence TGCCGGAGCATTCGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279027_1070279032 13 Left 1070279027 10:75035434-75035456 CCTCAGCCTCGAATGCTCCGGCA No data
Right 1070279032 10:75035470-75035492 TGTGCCTTCAAGTCTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279027 Original CRISPR TGCCGGAGCATTCGAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr