ID: 1070279104

View in Genome Browser
Species Human (GRCh38)
Location 10:75036022-75036044
Sequence CCAACCTAGGCTTCCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279104_1070279109 -6 Left 1070279104 10:75036022-75036044 CCTGATGGGGAAGCCTAGGTTGG No data
Right 1070279109 10:75036039-75036061 GGTTGGGGCCACTATGACCCTGG No data
1070279104_1070279117 30 Left 1070279104 10:75036022-75036044 CCTGATGGGGAAGCCTAGGTTGG No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279104_1070279111 5 Left 1070279104 10:75036022-75036044 CCTGATGGGGAAGCCTAGGTTGG No data
Right 1070279111 10:75036050-75036072 CTATGACCCTGGATCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279104 Original CRISPR CCAACCTAGGCTTCCCCATC AGG (reversed) Intergenic
No off target data available for this crispr