ID: 1070279109

View in Genome Browser
Species Human (GRCh38)
Location 10:75036039-75036061
Sequence GGTTGGGGCCACTATGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279099_1070279109 9 Left 1070279099 10:75036007-75036029 CCGGGGTAGCAGGATCCTGATGG No data
Right 1070279109 10:75036039-75036061 GGTTGGGGCCACTATGACCCTGG No data
1070279104_1070279109 -6 Left 1070279104 10:75036022-75036044 CCTGATGGGGAAGCCTAGGTTGG No data
Right 1070279109 10:75036039-75036061 GGTTGGGGCCACTATGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279109 Original CRISPR GGTTGGGGCCACTATGACCC TGG Intergenic
No off target data available for this crispr