ID: 1070279110

View in Genome Browser
Species Human (GRCh38)
Location 10:75036047-75036069
Sequence AAAGGGATCCAGGGTCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279110_1070279117 5 Left 1070279110 10:75036047-75036069 CCACTATGACCCTGGATCCCTTT No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279110_1070279118 12 Left 1070279110 10:75036047-75036069 CCACTATGACCCTGGATCCCTTT No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279110 Original CRISPR AAAGGGATCCAGGGTCATAG TGG (reversed) Intergenic
No off target data available for this crispr