ID: 1070279111

View in Genome Browser
Species Human (GRCh38)
Location 10:75036050-75036072
Sequence CTATGACCCTGGATCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279104_1070279111 5 Left 1070279104 10:75036022-75036044 CCTGATGGGGAAGCCTAGGTTGG No data
Right 1070279111 10:75036050-75036072 CTATGACCCTGGATCCCTTTTGG No data
1070279099_1070279111 20 Left 1070279099 10:75036007-75036029 CCGGGGTAGCAGGATCCTGATGG No data
Right 1070279111 10:75036050-75036072 CTATGACCCTGGATCCCTTTTGG No data
1070279108_1070279111 -8 Left 1070279108 10:75036035-75036057 CCTAGGTTGGGGCCACTATGACC No data
Right 1070279111 10:75036050-75036072 CTATGACCCTGGATCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279111 Original CRISPR CTATGACCCTGGATCCCTTT TGG Intergenic
No off target data available for this crispr