ID: 1070279113

View in Genome Browser
Species Human (GRCh38)
Location 10:75036057-75036079
Sequence ATGCAGGCCAAAAGGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279113_1070279117 -5 Left 1070279113 10:75036057-75036079 CCTGGATCCCTTTTGGCCTGCAT No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279113_1070279118 2 Left 1070279113 10:75036057-75036079 CCTGGATCCCTTTTGGCCTGCAT No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279113 Original CRISPR ATGCAGGCCAAAAGGGATCC AGG (reversed) Intergenic
No off target data available for this crispr