ID: 1070279114

View in Genome Browser
Species Human (GRCh38)
Location 10:75036064-75036086
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279114_1070279118 -5 Left 1070279114 10:75036064-75036086 CCCTTTTGGCCTGCATCTCTTTC No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279114 Original CRISPR GAAAGAGATGCAGGCCAAAA GGG (reversed) Intergenic
No off target data available for this crispr