ID: 1070279117

View in Genome Browser
Species Human (GRCh38)
Location 10:75036075-75036097
Sequence TGCATCTCTTTCCCAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279113_1070279117 -5 Left 1070279113 10:75036057-75036079 CCTGGATCCCTTTTGGCCTGCAT No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279108_1070279117 17 Left 1070279108 10:75036035-75036057 CCTAGGTTGGGGCCACTATGACC No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279110_1070279117 5 Left 1070279110 10:75036047-75036069 CCACTATGACCCTGGATCCCTTT No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279104_1070279117 30 Left 1070279104 10:75036022-75036044 CCTGATGGGGAAGCCTAGGTTGG No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data
1070279112_1070279117 -4 Left 1070279112 10:75036056-75036078 CCCTGGATCCCTTTTGGCCTGCA No data
Right 1070279117 10:75036075-75036097 TGCATCTCTTTCCCAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279117 Original CRISPR TGCATCTCTTTCCCAAGAGC TGG Intergenic
No off target data available for this crispr