ID: 1070279118

View in Genome Browser
Species Human (GRCh38)
Location 10:75036082-75036104
Sequence CTTTCCCAAGAGCTGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279108_1070279118 24 Left 1070279108 10:75036035-75036057 CCTAGGTTGGGGCCACTATGACC No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data
1070279114_1070279118 -5 Left 1070279114 10:75036064-75036086 CCCTTTTGGCCTGCATCTCTTTC No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data
1070279115_1070279118 -6 Left 1070279115 10:75036065-75036087 CCTTTTGGCCTGCATCTCTTTCC No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data
1070279110_1070279118 12 Left 1070279110 10:75036047-75036069 CCACTATGACCCTGGATCCCTTT No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data
1070279112_1070279118 3 Left 1070279112 10:75036056-75036078 CCCTGGATCCCTTTTGGCCTGCA No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data
1070279113_1070279118 2 Left 1070279113 10:75036057-75036079 CCTGGATCCCTTTTGGCCTGCAT No data
Right 1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279118 Original CRISPR CTTTCCCAAGAGCTGGAATA TGG Intergenic
No off target data available for this crispr