ID: 1070279460

View in Genome Browser
Species Human (GRCh38)
Location 10:75038072-75038094
Sequence TCTTACCTGCAGATGGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070279456_1070279460 -2 Left 1070279456 10:75038051-75038073 CCATGACGCAGTGAACCAGGATC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 12
4: 183
1070279451_1070279460 22 Left 1070279451 10:75038027-75038049 CCAGGGTGGCTGACCGGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 12
4: 183
1070279449_1070279460 28 Left 1070279449 10:75038021-75038043 CCAGGACCAGGGTGGCTGACCGG 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 12
4: 183
1070279453_1070279460 9 Left 1070279453 10:75038040-75038062 CCGGCTGCGGCCCATGACGCAGT 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 12
4: 183
1070279455_1070279460 -1 Left 1070279455 10:75038050-75038072 CCCATGACGCAGTGAACCAGGAT 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070279460 Original CRISPR TCTTACCTGCAGATGGAGCA GGG Exonic
902051287 1:13565458-13565480 TCTTTCCTGAAGATTGAGGACGG - Intergenic
904376086 1:30083375-30083397 TCTGTCCTGCAGATGGAGAAAGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904980272 1:34495004-34495026 TATTCCCTGCACCTGGAGCAGGG + Intergenic
905544763 1:38788873-38788895 TCTTTCCTGCAAAAGGAGCTTGG + Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
909261623 1:73496603-73496625 TCTTACCTAGGGATGGTGCATGG - Intergenic
910234863 1:85024921-85024943 TCCTAACTGCAGAGGGAGCCAGG - Intronic
910374341 1:86552665-86552687 TCGGACTTGCAGATGGAGCTGGG + Intronic
911874582 1:103143290-103143312 TCTTCCTTGCATATGGAGAAGGG - Intergenic
917061039 1:171039860-171039882 TCTTATTGGCAGGTGGAGCATGG - Intronic
917456720 1:175192355-175192377 TCCTACCGGCAGCTGGAGTAAGG + Intronic
917750077 1:178045001-178045023 TCTTTCCTGAAGATTGAGGACGG - Intergenic
919207620 1:194437506-194437528 TCTTGCATGCTGGTGGAGCAAGG - Intergenic
920206838 1:204298473-204298495 TCTTTTCTGCACATGGAGAATGG + Intronic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
921298959 1:213731542-213731564 TCTTACCTGTGGATGAAGAAGGG - Intergenic
921726304 1:218527414-218527436 TATTTGCTGCAAATGGAGCAAGG + Intergenic
922679835 1:227584469-227584491 CCTTAGCTGGAGATAGAGCAAGG - Intronic
923047496 1:230366319-230366341 GATTACCTGCAGATGGGGCTGGG + Intronic
923115446 1:230932888-230932910 TCATACCTGCAGAACGACCAAGG + Intronic
923554822 1:234992307-234992329 TCATACCTGCAGATTCTGCAGGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1064930080 10:20615261-20615283 TCTTTCCTGCAGAGAGAGCATGG - Intergenic
1065236861 10:23660757-23660779 TCTCCCCTGCAGATTGAGAATGG + Intergenic
1067082904 10:43221637-43221659 CCTAACCTGCAAATGCAGCAGGG - Intronic
1067550760 10:47234227-47234249 TCTTAACTTCAGGTGGAGAAAGG + Intergenic
1068125019 10:52828305-52828327 TGTTTCCTGCAGTTGGAGGAGGG - Intergenic
1069658689 10:70109191-70109213 TCTTACCTGCCGCTGGGGAAAGG - Exonic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1075094582 10:119462432-119462454 TCTTACCTGCAAATGGAAGCAGG + Intergenic
1076502999 10:130951687-130951709 TCTTATCTCCATATGGAGGATGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1084741318 11:71141122-71141144 TGTAACCTGCAGGTGGAGGAAGG - Intronic
1085921540 11:80963690-80963712 GTTGACCTGCAGATGGTGCAAGG - Intergenic
1085959941 11:81449867-81449889 TCTAACCTGCAGATGGCTAATGG - Intergenic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1091152560 11:133342427-133342449 TCCTACCTGTACATAGAGCAGGG + Intronic
1092067198 12:5600802-5600824 TCCTACATCCAGATGAAGCATGG - Intronic
1092925361 12:13267311-13267333 TCTTTTCTGCTGATGGAGCCTGG + Intergenic
1097048312 12:56204624-56204646 CCTTACCCTCAGATGGAGCCAGG - Exonic
1098924729 12:76336988-76337010 TCTGACTTAGAGATGGAGCATGG - Intergenic
1101728055 12:107404306-107404328 TCTTTCCAGCAGATGGGACATGG - Intronic
1102097003 12:110248925-110248947 TCTTATCTGCAGATGAGGCCAGG - Intergenic
1102499475 12:113341598-113341620 CCTTACCTTCAGGTGCAGCAGGG - Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1106186238 13:27412465-27412487 CCTTGCCTGGAGCTGGAGCAGGG - Intergenic
1106973608 13:35177405-35177427 TAGTACCTGCAAATGGAGCAAGG - Intronic
1107793961 13:44031103-44031125 TCCTTCCTTCAGAGGGAGCATGG - Intergenic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1110296527 13:73872708-73872730 TTTTAAGAGCAGATGGAGCAAGG - Intronic
1113665088 13:112135927-112135949 ACCTATCTGGAGATGGAGCATGG - Intergenic
1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG + Intergenic
1114939001 14:27582152-27582174 TACTACCTGCAGGTGGAGGATGG + Intergenic
1115954440 14:38762437-38762459 CCTTTCTTGCAGATGGTGCATGG - Intergenic
1118005652 14:61562455-61562477 TCTTACCTGCAGATCCAGCCTGG + Intronic
1118138783 14:63056928-63056950 TCATACCCGGAGGTGGAGCATGG + Intronic
1119936091 14:78593770-78593792 TCTTACCAGCAGATGCACCTGGG + Intronic
1122157122 14:99756333-99756355 TCTGCCCTGCTGATGTAGCAAGG + Intronic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1125267630 15:37901450-37901472 TATCACCTTCAGAGGGAGCATGG - Intergenic
1127354866 15:58188492-58188514 TCCTTCCTGCAGAGGAAGCAGGG + Intronic
1128336125 15:66786832-66786854 TCATCCCTGCAGGTGGAGGATGG - Intergenic
1129679832 15:77652453-77652475 TCTTACCTACAGCTGCAGCTGGG + Intronic
1130259940 15:82346821-82346843 TCTTACCTCCAGATCCTGCAGGG + Exonic
1130268785 15:82432615-82432637 TCTTACCTCCAGATCCTGCAGGG - Exonic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132765905 16:1534073-1534095 TCCTTCCTGCACCTGGAGCAGGG - Exonic
1135613137 16:23886221-23886243 TTTGACTTGCAGATGGATCAAGG + Intronic
1138512836 16:57518552-57518574 AGTGACCTGCTGATGGAGCAGGG + Intronic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1141719637 16:85749145-85749167 TCTTACCTGCAGTGGAAGCCAGG - Intronic
1143368392 17:6423049-6423071 TATGGCCTGCAGAGGGAGCAAGG - Intronic
1144576587 17:16433583-16433605 TCTGTCCTGGAGATGGAGAATGG + Exonic
1144966632 17:19080585-19080607 GCTAACCTGCAGATGCATCAGGG + Intergenic
1144981286 17:19171472-19171494 GCTAACCTGCAGATGCATCAGGG - Intergenic
1144986938 17:19206767-19206789 GCTAACCTGCAGATGCATCAGGG + Intergenic
1145839642 17:27983739-27983761 TCTTCCCTGCATATTGAGAAGGG + Intergenic
1145902798 17:28499024-28499046 TCCTCCTTGCAGATGGAGCTGGG - Intronic
1147744433 17:42686643-42686665 TCTTATCTGCAGATGGGGTCAGG - Intronic
1152348720 17:79771023-79771045 CCTTTCCTGCTGATGCAGCAGGG + Intergenic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1152993492 18:384440-384462 TGTTACCTGCAGATAGATGAAGG + Intronic
1153716737 18:7857610-7857632 CCCTTCCTGCAAATGGAGCATGG + Intronic
1157369816 18:47100408-47100430 TCTCACCAGCAGATGGAGCCTGG + Intronic
1158824131 18:61195248-61195270 TTTTTCCAGCAGATAGAGCATGG + Intergenic
1159026235 18:63184313-63184335 ACTTCCCTGCAGAGAGAGCATGG + Intronic
1160540909 18:79621953-79621975 TCTTGCTGGCAGCTGGAGCAGGG - Intergenic
1163193422 19:15696695-15696717 TCAGACCAGCAGATGGAGAAGGG - Intronic
1163200082 19:15760611-15760633 TCAGACCAGCAGATGGAGGAGGG + Intergenic
1163410313 19:17149871-17149893 CCAGACCTGCAGATGCAGCACGG + Intronic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1166104340 19:40590008-40590030 TCTTCCCTGCAGTGGGAGCAGGG + Intronic
1167411738 19:49348067-49348089 TCTGGCCAGCAGATGGAGGAAGG - Intronic
925415080 2:3664374-3664396 TCTTAACTACAAATGGAGCTTGG + Intronic
926077662 2:9954329-9954351 GATTACCAGCAGATTGAGCATGG - Intronic
927497294 2:23559496-23559518 TCGTGGCTGCAGATGGAGAAGGG + Intronic
928916156 2:36473288-36473310 TTTCACCGGCAGATTGAGCAGGG + Intronic
929746364 2:44663590-44663612 TCCTTCCTGCAGATGTGGCATGG + Intronic
935264939 2:101386580-101386602 TCTGACCTGGAGCTGAAGCAGGG - Intronic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
937207489 2:120245977-120245999 TCTTACCTCCTGGTGGAGCGAGG + Intronic
937342369 2:121099448-121099470 CCTCACCTGCAGACGGAACAGGG - Intergenic
943694390 2:190908637-190908659 TCTTACCTTAAGACAGAGCAGGG + Intronic
943756871 2:191566131-191566153 TCTTATCTGCTTATTGAGCAAGG + Intergenic
944088648 2:195878834-195878856 TCTTACCAGAAGATGGTGAAAGG + Intronic
946428068 2:219610168-219610190 TCTTGGCGGCAGCTGGAGCAGGG + Intronic
946868715 2:224066567-224066589 TCCTACTTGCGGGTGGAGCAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948594609 2:239071685-239071707 TCATAACAGGAGATGGAGCACGG - Intronic
948699309 2:239750420-239750442 TCACACCTGCAGAACGAGCATGG + Intergenic
1169394388 20:5216774-5216796 TCTTGGCTGCAGGTGCAGCAGGG - Intergenic
1171276243 20:23858519-23858541 TAGGACCTGGAGATGGAGCACGG + Intergenic
1172186096 20:33031937-33031959 TCTAACTTGCAGGGGGAGCATGG - Intronic
1173652514 20:44675784-44675806 TCTTTCCTGAAGATTGAGGACGG - Intergenic
1175249084 20:57598107-57598129 CCTGACCTGCAGGTGGAGCTGGG + Intergenic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1178117519 21:29432617-29432639 TCTTTCCTGCAGAAGAAGGATGG + Intronic
1179798529 21:43799566-43799588 TCAGCCCTGCAGATGGAGCCTGG - Exonic
1180972888 22:19824808-19824830 TCCTCCCTACAGATGAAGCAGGG + Intronic
1181985548 22:26797888-26797910 ACTGAGCTTCAGATGGAGCAGGG + Intergenic
1182871500 22:33651514-33651536 TCTTGCCTGCAAATGGAAGAAGG - Intronic
1183710199 22:39498841-39498863 CCTTAGCTGCAGGGGGAGCAGGG - Intergenic
1183951580 22:41355745-41355767 TCTGTCCTGCAGCTGGACCAAGG + Exonic
950389887 3:12688237-12688259 TCTTATCTTCAAATGGAGCAAGG + Intergenic
951131002 3:19044952-19044974 TCTCACCTGGAGATCGTGCATGG + Intergenic
953194929 3:40723287-40723309 CCCTCCCTGCAGATGGGGCAGGG - Intergenic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
955399588 3:58581876-58581898 TCTTAGCTGCAGAAGGACCCTGG + Intronic
955515750 3:59724923-59724945 TCTTACCAGCATGTTGAGCAAGG + Intergenic
956867704 3:73385775-73385797 TCTTGCCTGCAGCTGGATGAGGG - Exonic
959544523 3:107578674-107578696 TCCTTCCTGCAGATGGAGTCAGG - Intronic
961724001 3:128913979-128914001 TCTTACATGCCAATGGAGAATGG + Intronic
964098434 3:152961176-152961198 TCTTACCTGCAGAATGTACAGGG - Intergenic
964389722 3:156184730-156184752 ACTTACCTTCAGGTGGAGGAAGG - Intronic
968289226 3:197525864-197525886 ACAGACCTGCAGAGGGAGCACGG - Intronic
975842143 4:78486470-78486492 GGTTACCTGCTGATGGCGCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976386889 4:84470399-84470421 TCCAGCCAGCAGATGGAGCAAGG + Intergenic
978593954 4:110356530-110356552 TCTTGCCTGCAAATGGGTCAGGG + Intergenic
982714123 4:158788899-158788921 TCTTGCCTAAAGATGAAGCATGG - Intronic
983454878 4:167951556-167951578 TCTTACCTGAGGGTGGAGGATGG - Intergenic
983829949 4:172313960-172313982 CGTTTCCTGCAGGTGGAGCATGG - Intronic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
986299717 5:6468313-6468335 TCCTCCCTGGAGCTGGAGCAGGG + Intronic
986746541 5:10749953-10749975 TCCTTTCTGCAGATGAAGCAGGG - Intronic
988493569 5:31725993-31726015 TCTTCCCTGCAGATGCATAATGG + Intronic
990887341 5:60609573-60609595 TGTCACCTGCAGCTGGAGCATGG + Intronic
991996662 5:72394487-72394509 TCTTAACTCCAGATGGTCCAAGG + Intergenic
994996740 5:107073262-107073284 TTTTACCTGCAGAGAGTGCAAGG - Intergenic
995783411 5:115802247-115802269 TCTTACCTGCAGCTGGAGCTTGG - Intergenic
995862824 5:116660328-116660350 TCTGACCTCCAGCTGCAGCAGGG + Intergenic
996358286 5:122620110-122620132 CCTTTCCTGAAGATGGAGGACGG + Intergenic
996574623 5:124967579-124967601 CCTTTCCTGAAGATGGAGGACGG + Intergenic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
1000110751 5:158105986-158106008 TCTTCCTTGCAGAGGAAGCATGG - Intergenic
1001526090 5:172429854-172429876 GCTTGGCTGCAGCTGGAGCATGG + Intronic
1002383749 5:178850277-178850299 CCTTACATACAGATTGAGCAGGG - Intergenic
1003047475 6:2747042-2747064 TCTTACTTGTAAATGGAGAAGGG - Intronic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003535400 6:6971425-6971447 TGTCACCTGCAGCTGGGGCATGG - Intergenic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1008433213 6:51445269-51445291 TCTTAACTGCAGACTGAGAACGG - Intergenic
1008735619 6:54540101-54540123 CCTTTCCTGCACATGGAGAATGG - Intergenic
1011166025 6:84447347-84447369 TCTTACCTGTAGAATGAACATGG + Intergenic
1017029611 6:150209259-150209281 CCTCACCTGAAGATGGATCATGG - Intronic
1017642722 6:156510013-156510035 TCTTACCTGCAGCTGGCTCCCGG + Intergenic
1018369597 6:163155774-163155796 TCTTACCTGCAGTCGGAGTGGGG - Intronic
1018933126 6:168255237-168255259 TTTTACCTGGAGATTGGGCATGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019933772 7:4240984-4241006 TCTTTCCTGCAGAATGAGCCGGG + Intronic
1020218850 7:6218406-6218428 TCTCTCCTCCAGATGGAGCACGG + Intronic
1022339465 7:29454735-29454757 TCCTAACTTCAGATGGAACAAGG + Intronic
1023522869 7:41066274-41066296 TCTTTTCTGCAGGTGGAGCTTGG - Intergenic
1024151407 7:46575597-46575619 TCTTACTTGAAGAGGGAGGATGG + Intergenic
1025627430 7:63234032-63234054 TCTCACGTCCAGGTGGAGCACGG - Intergenic
1025732792 7:64121344-64121366 TCTCACGTGCAGATGGATGAGGG + Intronic
1037522626 8:19694893-19694915 TCTTTGCTGCAGAGGCAGCATGG - Intronic
1039663017 8:39487699-39487721 CCTTACCTGCATATTAAGCAGGG - Intergenic
1042185717 8:66134795-66134817 GCTTCCCTGCAGGTGTAGCAGGG - Intronic
1044364471 8:91326803-91326825 TAGAACCTGCAGAGGGAGCATGG - Intronic
1045173707 8:99697690-99697712 TCACACCTGGAGATGGACCAGGG + Intronic
1047600308 8:126419432-126419454 TCGTGCCTTCAGAGGGAGCATGG + Intergenic
1047644914 8:126860269-126860291 GCTTACCTGAAGCTGGTGCATGG - Intergenic
1048851802 8:138652448-138652470 TCTGATCTGCAAATGGGGCAAGG - Intronic
1052738821 9:32373908-32373930 AGATGCCTGCAGATGGAGCATGG + Intergenic
1056929355 9:90861618-90861640 CCTTTCCTGCAGTGGGAGCATGG + Intronic
1060264990 9:122106605-122106627 TGTTACCTGCAGATAGAGTATGG - Intergenic
1061371837 9:130201747-130201769 TCCAAGCTGCAGATGGGGCAGGG + Intronic
1061588797 9:131584859-131584881 TCGAATCTGCAGGTGGAGCATGG + Intronic
1062501260 9:136852969-136852991 TCAGACCAGGAGATGGAGCAGGG - Intronic
1187424054 X:19161208-19161230 GATGACCTGCAGATGGAGCGTGG - Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1193161999 X:78238715-78238737 TCTTACCTCCAGTGGCAGCATGG - Intergenic
1196679733 X:118458589-118458611 TTTTACCTGCTGATGGAGCTGGG - Intergenic
1200147233 X:153932579-153932601 TCTTCCCTGGAGAGGGAGAAAGG + Exonic
1200790862 Y:7298003-7298025 TCTGAAGTGCAGATGCAGCAGGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic