ID: 1070280842

View in Genome Browser
Species Human (GRCh38)
Location 10:75047145-75047167
Sequence GAGGCCCACCACAAGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070280832_1070280842 28 Left 1070280832 10:75047094-75047116 CCTGAGGCAGAGAAAGGGGCTCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG No data
1070280840_1070280842 -9 Left 1070280840 10:75047131-75047153 CCCGGTGGGTATTTGAGGCCCAC 0: 1
1: 0
2: 0
3: 1
4: 100
Right 1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG No data
1070280837_1070280842 -1 Left 1070280837 10:75047123-75047145 CCCTGAGACCCGGTGGGTATTTG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG No data
1070280838_1070280842 -2 Left 1070280838 10:75047124-75047146 CCTGAGACCCGGTGGGTATTTGA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG No data
1070280841_1070280842 -10 Left 1070280841 10:75047132-75047154 CCGGTGGGTATTTGAGGCCCACC 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070280842 Original CRISPR GAGGCCCACCACAAGTTTTC AGG Intronic
No off target data available for this crispr