ID: 1070281324

View in Genome Browser
Species Human (GRCh38)
Location 10:75050981-75051003
Sequence CTCAAGGGGATTCACCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070281324_1070281333 24 Left 1070281324 10:75050981-75051003 CCCACTTGGTGAATCCCCTTGAG No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281324_1070281329 -9 Left 1070281324 10:75050981-75051003 CCCACTTGGTGAATCCCCTTGAG No data
Right 1070281329 10:75050995-75051017 CCCCTTGAGCTAACCTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070281324 Original CRISPR CTCAAGGGGATTCACCAAGT GGG (reversed) Intronic