ID: 1070281325

View in Genome Browser
Species Human (GRCh38)
Location 10:75050982-75051004
Sequence GCTCAAGGGGATTCACCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070281325_1070281329 -10 Left 1070281325 10:75050982-75051004 CCACTTGGTGAATCCCCTTGAGC No data
Right 1070281329 10:75050995-75051017 CCCCTTGAGCTAACCTGGGATGG No data
1070281325_1070281334 30 Left 1070281325 10:75050982-75051004 CCACTTGGTGAATCCCCTTGAGC No data
Right 1070281334 10:75051035-75051057 TTTTGAAACCCGCAGGCCCAAGG No data
1070281325_1070281333 23 Left 1070281325 10:75050982-75051004 CCACTTGGTGAATCCCCTTGAGC No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070281325 Original CRISPR GCTCAAGGGGATTCACCAAG TGG (reversed) Intronic