ID: 1070281330

View in Genome Browser
Species Human (GRCh38)
Location 10:75050996-75051018
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070281330_1070281333 9 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281330_1070281337 29 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA No data
Right 1070281337 10:75051048-75051070 AGGCCCAAGGAACTTTGATATGG No data
1070281330_1070281334 16 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA No data
Right 1070281334 10:75051035-75051057 TTTTGAAACCCGCAGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070281330 Original CRISPR TCCATCCCAGGTTAGCTCAA GGG (reversed) Intronic