ID: 1070281330

View in Genome Browser
Species Human (GRCh38)
Location 10:75050996-75051018
Sequence TCCATCCCAGGTTAGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070281330_1070281333 9 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA 0: 1
1: 0
2: 2
3: 10
4: 89
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281330_1070281334 16 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA 0: 1
1: 0
2: 2
3: 10
4: 89
Right 1070281334 10:75051035-75051057 TTTTGAAACCCGCAGGCCCAAGG No data
1070281330_1070281337 29 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA 0: 1
1: 0
2: 2
3: 10
4: 89
Right 1070281337 10:75051048-75051070 AGGCCCAAGGAACTTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070281330 Original CRISPR TCCATCCCAGGTTAGCTCAA GGG (reversed) Intronic
901841839 1:11958437-11958459 TCCACCCCAGGGTGGCCCAAGGG - Intronic
923569954 1:235104456-235104478 TCCAGCCCAGTTTAGAACAAGGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1067768766 10:49108815-49108837 TCCATCACAGGTCAGCTCAGGGG - Intronic
1068861641 10:61854014-61854036 TCCATACCAGGACAGCTCCAAGG + Intergenic
1068888950 10:62128181-62128203 TCCAAGCCAGATAAGCTCAAGGG - Intergenic
1069822974 10:71239034-71239056 ACCATCCCAGGACAGCTCAAGGG - Intronic
1070235703 10:74623073-74623095 TCCATACCATGTTAACTCATTGG + Intronic
1070281330 10:75050996-75051018 TCCATCCCAGGTTAGCTCAAGGG - Intronic
1074616828 10:115077967-115077989 TCCCACCTAGGTTACCTCAAGGG - Intergenic
1077366527 11:2163506-2163528 TCCATCCCTGTTTCTCTCAAGGG + Intergenic
1078935351 11:15944597-15944619 TTCCTTCCAGGTTAGCTGAATGG + Intergenic
1079124925 11:17712150-17712172 TCCATACCACGTTAGCTCAAGGG + Intergenic
1090520919 11:127478174-127478196 CTCATCCCAGGTTACATCAATGG + Intergenic
1093756497 12:22858927-22858949 TCCTTCCCTGGTTAGCTACAGGG - Intergenic
1095866931 12:46982868-46982890 TTCATCCCAAGTTAGCTCCAGGG - Intergenic
1096242962 12:49969121-49969143 GCTGTCCCAGGGTAGCTCAAGGG - Intronic
1098116753 12:67186956-67186978 TCAATCCCAGGCCAGCTCCACGG + Intergenic
1100504408 12:95205630-95205652 TACATTTCAGGTGAGCTCAAAGG - Intronic
1101207402 12:102502301-102502323 TCCTTCCCAGGTTTGCTAAAGGG - Intergenic
1102645596 12:114401609-114401631 TCCATCCTAGGAGAGATCAATGG + Intronic
1102880802 12:116482996-116483018 TCCACCCCAGGTTAGGCCACTGG + Intergenic
1108151909 13:47544887-47544909 TCCATCCTAGGTCAGATCTATGG - Intergenic
1110458067 13:75712182-75712204 TAAATCCCAGGTTGGCTCCAGGG - Intronic
1113906173 13:113820206-113820228 TCCCTCCCAGGTTGGCTCAGAGG + Intergenic
1115075574 14:29385695-29385717 GCCATACCAGGTTAACTAAATGG + Intergenic
1120439363 14:84516349-84516371 TCCATCCCTGGTCATCTCACTGG + Intergenic
1124623927 15:31297466-31297488 CCCACCCCTGGTGAGCTCAATGG - Intergenic
1124941798 15:34225167-34225189 TCCAGGCCCGCTTAGCTCAATGG - Exonic
1126424756 15:48515356-48515378 TCCATCCTAGGTTGGCACCAAGG - Intronic
1127373559 15:58362097-58362119 TCCATCTCAGGTTTACTCACCGG - Intronic
1129253746 15:74322476-74322498 TCTATCCTGGGTTAGCTCCAGGG - Intronic
1129549470 15:76432137-76432159 TGCATCACAGGGTAGCCCAAGGG + Intronic
1134211233 16:12279383-12279405 TCTAACTCAGGTGAGCTCAAGGG + Intronic
1138502156 16:57453568-57453590 TCCATCCCAGGCTTGCTGCAGGG + Intronic
1146056889 17:29585779-29585801 TCCGTCCCAGGTTTGGTCCAAGG - Intronic
1148716649 17:49720565-49720587 TCCATCTCAAAATAGCTCAATGG + Intronic
925469398 2:4142769-4142791 TCCATCAGAGCTCAGCTCAAGGG + Intergenic
926705706 2:15835968-15835990 TGAGTCCCAGGTTAGCTGAATGG - Intergenic
927958567 2:27225146-27225168 TCGATCCTCGGTCAGCTCAATGG - Exonic
928605902 2:32945438-32945460 TGCCTCCCAGGTTGGTTCAAAGG - Intergenic
928844467 2:35653728-35653750 TCCATCCTAATATAGCTCAAAGG + Intergenic
928973882 2:37063093-37063115 CCCAGGCAAGGTTAGCTCAATGG + Intronic
932409246 2:71535437-71535459 TCCATCCCTGGCTACCCCAAGGG - Intronic
936861233 2:117023040-117023062 CCCATCTCAGGTAAGCTCTAAGG + Intergenic
937823075 2:126334126-126334148 ACCCTCCCAAGTTAGCTCCAGGG - Intergenic
940061426 2:149574542-149574564 TCCAACTCAGGTTAGCTAAGGGG - Intronic
941652970 2:168113135-168113157 TCCATACCAGGATATGTCAAAGG + Intronic
942897611 2:181076424-181076446 TCCTTCCCAGGTTCCCTAAAGGG + Intronic
945280520 2:208031145-208031167 TTAATCCCATGTTATCTCAAGGG + Intergenic
945757273 2:213862619-213862641 TCCATCCCAGGTCAGTGCACAGG + Exonic
947389530 2:229624872-229624894 TCCTGCTGAGGTTAGCTCAATGG + Intronic
947624372 2:231610650-231610672 TCCATCCCAGCTGGGCTTAAGGG - Intergenic
1182875130 22:33685039-33685061 TCCATCCCATCTCATCTCAAGGG - Intronic
1182881543 22:33738234-33738256 CCCAACCCAGGTGTGCTCAAAGG + Intronic
1182976742 22:34629238-34629260 TCTACCCCAAGTTAGCTCCAGGG - Intergenic
961709577 3:128817634-128817656 TTAATCCAAGGTTACCTCAAGGG - Intergenic
964027023 3:152086962-152086984 TCCATCCCCAGTTAGACCAAGGG - Intergenic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
975695174 4:77005847-77005869 TCCATCCCAGGTAAATTTAAAGG + Intronic
979314690 4:119248004-119248026 TCAGTCCCATGTTAGCTCAAAGG - Intronic
979613907 4:122719779-122719801 TCAAGCCCAGGTTAGATGAAGGG + Intergenic
985622559 5:963092-963114 TCCATACCAGGGAAGCTCCAAGG - Intergenic
986199295 5:5567168-5567190 TGCTTCCCAGGTAAGCTCATTGG + Intergenic
992343209 5:75847961-75847983 TCCATGCCAGCTTAGCAAAATGG + Intergenic
1001399003 5:171435726-171435748 TCCATCCCAGGGTAGCTGTGAGG - Intronic
1002174067 5:177391484-177391506 CCCAGCCCAGGTTAGGTCAGTGG + Intronic
1003512826 6:6795808-6795830 TGCTTCCCAGGTGACCTCAAAGG + Intergenic
1004262797 6:14122916-14122938 TACATCACTGGTTACCTCAATGG - Intronic
1004347770 6:14864276-14864298 CCCATCCATGGTTAGCTGAAGGG - Intergenic
1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG + Intergenic
1005739486 6:28776894-28776916 TGCAATCCTGGTTAGCTCAAGGG - Intergenic
1006460293 6:34154160-34154182 TCCAGCCCAGGTTTCCTCATTGG + Intronic
1007025446 6:38567702-38567724 TGGATACAAGGTTAGCTCAAGGG - Intronic
1010777759 6:79906529-79906551 ACCATCCCATGTTTGCTCACTGG - Intergenic
1012676225 6:102116036-102116058 TCCCTCCCAAGTTAGCTCCAGGG + Intergenic
1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG + Intergenic
1016487364 6:144556152-144556174 TCCATCTTAGGCTAGCTGAAGGG - Intronic
1016618346 6:146079022-146079044 TGAATCCCAGGTTAGCACACAGG + Intronic
1022446565 7:30475613-30475635 ATCATCCCCGGTTGGCTCAATGG + Intronic
1023911775 7:44561558-44561580 TCCGTCCCAGGTGAGCCCAAAGG - Intergenic
1026470670 7:70692435-70692457 ACAATACCAGGATAGCTCAAAGG - Intronic
1028434494 7:90786103-90786125 TCATTCCCAGCTTAGCCCAAAGG - Intronic
1033236792 7:139644478-139644500 TCCTGCCCAGGTGAGCGCAAAGG + Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1039175009 8:34793715-34793737 CCCATCCCAAGTTAGCTCAGAGG + Intergenic
1042958921 8:74281852-74281874 TCCTTCCCAGGAGAGCTGAATGG + Intronic
1046794897 8:118360307-118360329 TGAATGCCAGGTTAACTCAAGGG + Intronic
1049984309 9:933993-934015 TGCATCACAGGTTAGGTCCAAGG - Intronic
1051466544 9:17384453-17384475 TCCTGCCCAGGTAAACTCAAAGG + Intronic
1052791563 9:32879743-32879765 TCCCTCCCAGGTTAGCACCCAGG - Intergenic
1057694829 9:97315721-97315743 TCCAGCCCATGTCAGCTCCATGG + Intronic
1058743225 9:107965288-107965310 TCCACACCAGATTAGCTCCAAGG - Intergenic
1062697024 9:137880749-137880771 TCCATCCCAGGGGACATCAATGG - Intronic
1186195432 X:7106895-7106917 TCAAACCCAGGTAAGCTCCATGG + Intronic
1193240480 X:79163426-79163448 TCCATTCTGGGTTAACTCAAAGG - Intergenic
1195939485 X:110156184-110156206 TCCTTTGCAAGTTAGCTCAAGGG + Intronic
1197169181 X:123412171-123412193 GCAATCCCAGGAGAGCTCAATGG + Intronic
1198975621 X:142332808-142332830 TCTCTCCCAAGTTAGCTCCATGG - Intergenic
1199900758 X:152169693-152169715 TCCATCCCAGTTTGGCTCTAGGG + Intronic
1201533806 Y:15023103-15023125 TCCATTCCATGTGAGCTCATGGG + Intergenic