ID: 1070281332

View in Genome Browser
Species Human (GRCh38)
Location 10:75051008-75051030
Sequence TAAAGCATTTTCTCCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070281332_1070281337 17 Left 1070281332 10:75051008-75051030 CCTGGGATGGAGAAAATGCTTTA No data
Right 1070281337 10:75051048-75051070 AGGCCCAAGGAACTTTGATATGG No data
1070281332_1070281334 4 Left 1070281332 10:75051008-75051030 CCTGGGATGGAGAAAATGCTTTA No data
Right 1070281334 10:75051035-75051057 TTTTGAAACCCGCAGGCCCAAGG No data
1070281332_1070281333 -3 Left 1070281332 10:75051008-75051030 CCTGGGATGGAGAAAATGCTTTA No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281332_1070281340 30 Left 1070281332 10:75051008-75051030 CCTGGGATGGAGAAAATGCTTTA No data
Right 1070281340 10:75051061-75051083 TTTGATATGGCTGCCTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070281332 Original CRISPR TAAAGCATTTTCTCCATCCC AGG (reversed) Intronic