ID: 1070281333

View in Genome Browser
Species Human (GRCh38)
Location 10:75051028-75051050
Sequence TTAGCGATTTTGAAACCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070281325_1070281333 23 Left 1070281325 10:75050982-75051004 CCACTTGGTGAATCCCCTTGAGC No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281328_1070281333 10 Left 1070281328 10:75050995-75051017 CCCCTTGAGCTAACCTGGGATGG No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281332_1070281333 -3 Left 1070281332 10:75051008-75051030 CCTGGGATGGAGAAAATGCTTTA No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281331_1070281333 8 Left 1070281331 10:75050997-75051019 CCTTGAGCTAACCTGGGATGGAG No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281330_1070281333 9 Left 1070281330 10:75050996-75051018 CCCTTGAGCTAACCTGGGATGGA No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data
1070281324_1070281333 24 Left 1070281324 10:75050981-75051003 CCCACTTGGTGAATCCCCTTGAG No data
Right 1070281333 10:75051028-75051050 TTAGCGATTTTGAAACCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070281333 Original CRISPR TTAGCGATTTTGAAACCCGC AGG Intronic