ID: 1070282885

View in Genome Browser
Species Human (GRCh38)
Location 10:75062647-75062669
Sequence GGTGCACACAGGCCGCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070282885_1070282893 21 Left 1070282885 10:75062647-75062669 CCTGAAGGCGGCCTGTGTGCACC No data
Right 1070282893 10:75062691-75062713 CTCTAATTCTCAGAGAGGCCAGG No data
1070282885_1070282892 16 Left 1070282885 10:75062647-75062669 CCTGAAGGCGGCCTGTGTGCACC No data
Right 1070282892 10:75062686-75062708 CAACTCTCTAATTCTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070282885 Original CRISPR GGTGCACACAGGCCGCCTTC AGG (reversed) Intergenic
No off target data available for this crispr