ID: 1070284163

View in Genome Browser
Species Human (GRCh38)
Location 10:75071452-75071474
Sequence CACAGTAGATGAGGGGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070284163_1070284175 22 Left 1070284163 10:75071452-75071474 CCCTAAGCCCCTCATCTACTGTG No data
Right 1070284175 10:75071497-75071519 TGCCACCCGCAGACAGGACCAGG No data
1070284163_1070284171 -4 Left 1070284163 10:75071452-75071474 CCCTAAGCCCCTCATCTACTGTG No data
Right 1070284171 10:75071471-75071493 TGTGGGGTCAACAACAGCCACGG No data
1070284163_1070284174 16 Left 1070284163 10:75071452-75071474 CCCTAAGCCCCTCATCTACTGTG No data
Right 1070284174 10:75071491-75071513 CGGGAGTGCCACCCGCAGACAGG No data
1070284163_1070284172 -3 Left 1070284163 10:75071452-75071474 CCCTAAGCCCCTCATCTACTGTG No data
Right 1070284172 10:75071472-75071494 GTGGGGTCAACAACAGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070284163 Original CRISPR CACAGTAGATGAGGGGCTTA GGG (reversed) Intergenic
No off target data available for this crispr