ID: 1070286083

View in Genome Browser
Species Human (GRCh38)
Location 10:75084976-75084998
Sequence CCTTCCCACTTTGACACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070286080_1070286083 5 Left 1070286080 10:75084948-75084970 CCCAGCAGAGCTGCGCAAGGCTG No data
Right 1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG No data
1070286077_1070286083 9 Left 1070286077 10:75084944-75084966 CCCTCCCAGCAGAGCTGCGCAAG No data
Right 1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG No data
1070286078_1070286083 8 Left 1070286078 10:75084945-75084967 CCTCCCAGCAGAGCTGCGCAAGG No data
Right 1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG No data
1070286076_1070286083 12 Left 1070286076 10:75084941-75084963 CCACCCTCCCAGCAGAGCTGCGC No data
Right 1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG No data
1070286081_1070286083 4 Left 1070286081 10:75084949-75084971 CCAGCAGAGCTGCGCAAGGCTGT No data
Right 1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070286083 Original CRISPR CCTTCCCACTTTGACACTTG AGG Intergenic
No off target data available for this crispr