ID: 1070286863

View in Genome Browser
Species Human (GRCh38)
Location 10:75089974-75089996
Sequence TTCAAACACAGGTAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070286863_1070286867 -6 Left 1070286863 10:75089974-75089996 CCCTCCATCTACCTGTGTTTGAA No data
Right 1070286867 10:75089991-75090013 TTTGAATAAAAAATAAAGCATGG No data
1070286863_1070286868 -1 Left 1070286863 10:75089974-75089996 CCCTCCATCTACCTGTGTTTGAA No data
Right 1070286868 10:75089996-75090018 ATAAAAAATAAAGCATGGCCTGG No data
1070286863_1070286870 9 Left 1070286863 10:75089974-75089996 CCCTCCATCTACCTGTGTTTGAA No data
Right 1070286870 10:75090006-75090028 AAGCATGGCCTGGCCAGGTGTGG No data
1070286863_1070286871 12 Left 1070286863 10:75089974-75089996 CCCTCCATCTACCTGTGTTTGAA No data
Right 1070286871 10:75090009-75090031 CATGGCCTGGCCAGGTGTGGTGG No data
1070286863_1070286869 4 Left 1070286863 10:75089974-75089996 CCCTCCATCTACCTGTGTTTGAA No data
Right 1070286869 10:75090001-75090023 AAATAAAGCATGGCCTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070286863 Original CRISPR TTCAAACACAGGTAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr