ID: 1070288722

View in Genome Browser
Species Human (GRCh38)
Location 10:75101087-75101109
Sequence GTGGGGAGAAGGCCTGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070288712_1070288722 19 Left 1070288712 10:75101045-75101067 CCATGTGGGGCTGGAGATCTCAG 0: 1
1: 1
2: 3
3: 18
4: 189
Right 1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG No data
1070288711_1070288722 26 Left 1070288711 10:75101038-75101060 CCACAGGCCATGTGGGGCTGGAG 0: 1
1: 0
2: 1
3: 51
4: 430
Right 1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070288722 Original CRISPR GTGGGGAGAAGGCCTGCAGA AGG Intronic
No off target data available for this crispr