ID: 1070290667

View in Genome Browser
Species Human (GRCh38)
Location 10:75111520-75111542
Sequence GGCCGCCGTCACCGCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070290667_1070290673 24 Left 1070290667 10:75111520-75111542 CCGGCGCGGCGGTGACGGCGGCC 0: 1
1: 0
2: 1
3: 35
4: 281
Right 1070290673 10:75111567-75111589 CACCGCCCCCGCCTCCACTCCGG 0: 1
1: 0
2: 0
3: 50
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070290667 Original CRISPR GGCCGCCGTCACCGCCGCGC CGG (reversed) Intronic
900191775 1:1355162-1355184 GGGCGCGGTCAGCGGCGCGCGGG + Intronic
900341217 1:2190279-2190301 GGACGCCGTCACCGGCGTGCAGG + Intronic
900522399 1:3111969-3111991 GTCCTCCCTCGCCGCCGCGCCGG - Intronic
901443639 1:9293605-9293627 CGCCGCCCTCCCCGCCGCCCCGG + Intronic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
903115532 1:21176303-21176325 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903420916 1:23217406-23217428 GGCCGCCCGCCCCGCCGCCCCGG + Intergenic
903614757 1:24643556-24643578 GGCCACCGTCGCCGCCGCGTAGG - Intronic
903750620 1:25618147-25618169 GGCCGCCGTGGCCTCCTCGCGGG - Exonic
903998316 1:27322235-27322257 CGCCGCCGCCACCCCCGCCCAGG + Exonic
904063028 1:27726048-27726070 GGCCGCGCTCACCGACCCGCCGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904744453 1:32702571-32702593 GGCCCGCGTCGCCGCCCCGCTGG - Intronic
904744464 1:32702621-32702643 CGGCGCCGTCCCCGCCGCGCCGG + Exonic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905066890 1:35192251-35192273 GGCCGCCGGGCCCGCCGGGCGGG + Exonic
905137219 1:35808595-35808617 GGGCGCGGTCACCGCCCCCCAGG - Intronic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
906411697 1:45584170-45584192 TGCCGCCGTCGCCGCGGAGCTGG + Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
908796247 1:67833447-67833469 GGGCGCCGGCTCCGCCTCGCTGG + Exonic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
920912625 1:210232878-210232900 ACCCGCAGTCACCGCCGAGCGGG + Exonic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922250717 1:223846266-223846288 TGCCGCCGTCACCTCCTCGGCGG + Intergenic
923372728 1:233328664-233328686 GGCCGCTGCCAACGCCGCCCCGG + Exonic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
924289690 1:242524620-242524642 GGGCGACGTCGCCGCCGCACCGG - Intronic
1062890459 10:1056429-1056451 GGCCGCGGTGCCGGCCGCGCGGG - Intronic
1064011940 10:11742579-11742601 GGCCGCCGTCGCCGTCTTGCGGG + Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1064645441 10:17454592-17454614 TGCTGCCGCCGCCGCCGCGCGGG + Intergenic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1070768400 10:79069211-79069233 CGCCGCCGCCACCGCCGGGTAGG - Exonic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1071527693 10:86367437-86367459 CGCCGCGGTCACGGCTGCGCTGG - Intergenic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1074182877 10:111078749-111078771 GGACGCCGTCGCCGCGCCGCCGG + Exonic
1074503360 10:114045014-114045036 CGCCGCCGCCACCGCCCCGCTGG + Exonic
1075645050 10:124091883-124091905 ACCCGCCGTCCCAGCCGCGCCGG + Intronic
1075645440 10:124093259-124093281 CGCCACCGCCACCACCGCGCCGG + Intronic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1077053786 11:580139-580161 GGCCGGCTTCACTGCCTCGCTGG + Intronic
1077124364 11:925925-925947 GGTCGCCGTCACCGCCGCGGAGG - Exonic
1077134903 11:993671-993693 CGCCGCCGTCCCCCCCCCGCGGG + Intronic
1077322314 11:1947801-1947823 GGCGGCCCCCACCGCAGCGCGGG + Intronic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1080432348 11:32210559-32210581 GGCAGCCGTCACTGCTGCTCTGG - Intergenic
1081492584 11:43579622-43579644 GCCCGCCGCCGCCGCGGCGCGGG - Intronic
1083316301 11:61816719-61816741 GGCCGCCGAGACCGCGGCTCAGG - Exonic
1083965738 11:66042677-66042699 GGCCGGCGCCGCCGCCGGGCAGG + Exonic
1083965794 11:66042953-66042975 GGCCGCCATCCCCGCGGCGCTGG - Exonic
1084118774 11:67056892-67056914 GGCCGCCGTCATCCCGGGGCCGG - Exonic
1084150384 11:67285423-67285445 GGCCGTTGGCACTGCCGCGCTGG - Exonic
1084516069 11:69638546-69638568 GGCCGCGGTCACCGGGGCGGGGG + Intergenic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1086950127 11:92883089-92883111 GGCCGTCCCCACTGCCGCGCAGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1202805332 11_KI270721v1_random:3114-3136 GGCGGCCCCCACCGCAGCGCGGG + Intergenic
1091402476 12:189276-189298 GGCCGCAGACAGCGCTGCGCCGG + Intergenic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092172828 12:6384272-6384294 AGCCGCCGCCACCGCTGCCCAGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095261743 12:40105952-40105974 AGCCGCCGCCACGGCCGCTCCGG + Intronic
1096098956 12:48957338-48957360 GGCCGCCGCCTCTGCCCCGCAGG + Exonic
1096843138 12:54391132-54391154 GGCCGCAGTCACCGCGGTGCCGG + Intronic
1099315529 12:81078243-81078265 GGCCCCCGAGACCGCCCCGCGGG - Exonic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1101910518 12:108857543-108857565 CGCCACCGCCACCGCCGCCCGGG + Exonic
1101935375 12:109052695-109052717 GGCCGCGGTCATCGCCGCCTCGG - Exonic
1103459675 12:121093771-121093793 GCCGGCCGGCACCGCCGCCCCGG - Intergenic
1103527795 12:121579345-121579367 GGCTGCTGTTACCGCCGAGCCGG - Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1105405283 13:20128034-20128056 AGGGGCCGTCACCGCCCCGCGGG - Intergenic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1107481533 13:40789653-40789675 GGCTGCGCTCACCGCCGCGCCGG - Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1110558390 13:76885714-76885736 GGCCGCCGCCCTCGCGGCGCGGG - Exonic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1112507198 13:99982135-99982157 AGCCGCCGCCGCCGCCGCGGCGG - Exonic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117183666 14:53217774-53217796 GCCCGCCGGCACCGCCGGCCCGG - Intergenic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118854596 14:69611467-69611489 CGCCGCCGCGACCGCCCCGCCGG - Intergenic
1120953525 14:90062307-90062329 CGCCGCCGTCTTCTCCGCGCTGG + Exonic
1120993216 14:90396860-90396882 GGCCGCCGCGACTGGCGCGCAGG + Intronic
1121616958 14:95319817-95319839 GCCCGCCGCCCGCGCCGCGCTGG - Exonic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122975369 14:105168673-105168695 CGCCGCCGTCGCCGCCGGGTGGG - Exonic
1123024002 14:105415098-105415120 GGACGCGGTCTCCGGCGCGCAGG + Intronic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1125685123 15:41559307-41559329 TGCCGCCGCCACCGCGGCTCGGG + Exonic
1126800780 15:52295296-52295318 GGCCGCCCCCTCCGCCGCTCCGG - Intronic
1126852622 15:52806232-52806254 GGCCGCAGTCCCCGCGCCGCTGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130352877 15:83107353-83107375 GGGCGGCGACACCCCCGCGCAGG - Intergenic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1133209189 16:4253728-4253750 GGCCGCCGTCACCTGCTCTCCGG + Intergenic
1133219818 16:4315411-4315433 TGCCGCCTTCCCCGCCGCCCGGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1134034600 16:11020236-11020258 GGCCGCCAGCACCTCCGTGCAGG + Exonic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1136364938 16:29805663-29805685 GGCCGCCGTCGTTGCCGAGCGGG - Intergenic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136867777 16:33770536-33770558 TGCCGCCGTCGCCGCCGCCGCGG + Intergenic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138509044 16:57497378-57497400 GGCCGCCGTCACTGTCGTGGGGG + Intergenic
1139484046 16:67246385-67246407 CGCCGCCGTCAGCCCCCCGCAGG - Intronic
1139597856 16:67968607-67968629 CGCCGCTGTCCCCGCCGCCCCGG + Exonic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1142163333 16:88570625-88570647 GGCCGCCGCCGCCGCCTCGGCGG - Intronic
1203104393 16_KI270728v1_random:1345715-1345737 TGCCGCCGTCGCCGCCGCCCCGG - Intergenic
1203129121 16_KI270728v1_random:1616653-1616675 TGCCGCCGTCGCCGCCGCCCCGG + Intergenic
1142695192 17:1629340-1629362 CGCCGCCGTCCCCGCCGCCTCGG + Intergenic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1143596178 17:7915693-7915715 GGACGCCGCCAGCGCCGCGCAGG + Intergenic
1144021185 17:11241128-11241150 GGCCGCAGTCACCGCCGGCGGGG + Intergenic
1144695401 17:17301029-17301051 GGGCGCCGTCACAGCCCAGCCGG + Intergenic
1144953018 17:19004192-19004214 GCCCGCCCTCCCCGCCGAGCCGG - Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146763483 17:35498062-35498084 CGCCGCCCTCGCCGCCGCTCTGG - Intronic
1146955975 17:36936594-36936616 GCCCGCCGTCCGCGCCGCGCGGG + Intergenic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147740793 17:42670097-42670119 TGCGGCCGGCCCCGCCGCGCCGG + Exonic
1149712608 17:58756491-58756513 GCCCGCGGTCCCCACCGCGCCGG + Intronic
1150239857 17:63622666-63622688 CGCTGCCGTCCCCGCCGCCCGGG + Exonic
1151324140 17:73368452-73368474 GGCCGCCTTCAACGCCGCTGGGG - Exonic
1151422285 17:74006343-74006365 GGCCTCCTTCACCTCCACGCTGG - Intergenic
1151585078 17:75003876-75003898 GGCCCTCCTCACCCCCGCGCAGG - Exonic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152920728 17:83065277-83065299 GGGCTCCGTGACCGACGCGCAGG - Intergenic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1154169338 18:12039052-12039074 GCCCGCCTATACCGCCGCGCGGG - Intergenic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1160578381 18:79869873-79869895 AGCCGCCGCCACCACCACGCGGG + Intronic
1160865515 19:1254298-1254320 GGCCGCCGCCGCTGCTGCGCGGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1161265131 19:3360265-3360287 GGCCGCGCTCGGCGCCGCGCAGG + Intronic
1161901886 19:7125364-7125386 GACCGTCTTCACCGCCACGCGGG + Exonic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163546399 19:17943504-17943526 GGCCGCCTCCTCCGCCACGCTGG - Exonic
1165510969 19:36266525-36266547 CACCGCCGCCACCGCCGCCCCGG + Intergenic
1165721558 19:38082708-38082730 GGCCTCCCTCACGGCCTCGCGGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167072328 19:47228215-47228237 ACCCGCCGTCACCGCCGCCCTGG - Exonic
1168078509 19:53993012-53993034 GGCCGCCGTGGGCGCCACGCTGG + Exonic
1168305570 19:55433372-55433394 GGCCCCCAACACCGCTGCGCGGG - Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
925856643 2:8135249-8135271 GGCGGCCCTCACTGGCGCGCCGG + Intergenic
926154876 2:10448235-10448257 GGCCGGCGTCTCCGGCGGGCGGG - Exonic
926337962 2:11878592-11878614 GACCGCCATCACCACCACGCTGG - Intergenic
931256909 2:60581892-60581914 CGCCGCCTCCACCGCCCCGCGGG + Intergenic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
936671523 2:114662332-114662354 GGGCGCGGGCACCGCTGCGCGGG + Intronic
942046552 2:172102430-172102452 GGCCGGCGCCGCCGCCGCTCGGG + Exonic
942446158 2:176080283-176080305 CGCCGCCGCCACCGCCACCCCGG + Exonic
943670011 2:190649577-190649599 GGCCGCGCTCCCCGCCGCCCTGG - Intronic
944843147 2:203643091-203643113 GTCGGCCGGCACCGCCGCCCCGG - Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1170617909 20:17968903-17968925 GGCCGGCGTCTCCGAAGCGCGGG - Exonic
1171361620 20:24590273-24590295 GGCCCCCAGCCCCGCCGCGCCGG - Intronic
1172793401 20:37521330-37521352 GGCCGCCGCCACTGCCGCCATGG - Exonic
1175517220 20:59577393-59577415 GGCCGGCCTCTCCGCCGGGCGGG - Intergenic
1175847213 20:62065312-62065334 GCCCGCCGGCCCCGCCGCGCTGG - Exonic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176418919 21:6499016-6499038 CTCCCCCGCCACCGCCGCGCCGG + Intergenic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178922617 21:36748247-36748269 GGCCCTCGGCACCGGCGCGCGGG - Exonic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1179694412 21:43107338-43107360 CTCCCCCGCCACCGCCGCGCCGG + Intronic
1179882677 21:44300096-44300118 GGCCGCCGCCATGGCCGCGGTGG + Exonic
1180559227 22:16601981-16602003 GGCCGCCGCCGCCGCTGCTCGGG - Intergenic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1183452890 22:37906359-37906381 GGCCGCCGTCCCGGCCAAGCCGG + Exonic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1184069367 22:42138504-42138526 GGCCTCAGTCACCTCCCCGCGGG + Intergenic
1184136573 22:42553647-42553669 GGCCGCCCCCACGTCCGCGCGGG - Intronic
1184164720 22:42720606-42720628 GGTGGCCGGGACCGCCGCGCGGG + Intronic
1184362097 22:44024687-44024709 GCCCGAGGTCCCCGCCGCGCAGG - Intronic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
1185087895 22:48750431-48750453 GGCCGCCCTCTCCGCTCCGCCGG - Exonic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
950168038 3:10816255-10816277 CTCCGCCGTCATGGCCGCGCTGG - Exonic
950523999 3:13513095-13513117 GGCCGCAGTCACCCCCACACTGG + Intergenic
953657009 3:44862080-44862102 GGCCGCCGCCTCCGCCAAGCTGG + Exonic
953890054 3:46744657-46744679 GGCCGCAGTCACCACCCAGCTGG + Exonic
955059866 3:55485268-55485290 GGCAGCCGGCACCGCACCGCGGG + Intronic
956677933 3:71753417-71753439 GGCCACCGTGACCCCAGCGCGGG + Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961574454 3:127823222-127823244 GGCCGCCCCCGCCGCCGAGCCGG - Intronic
963882716 3:150546396-150546418 CGCCGCCGTCGCCGCCGCTTTGG + Exonic
966362931 3:179148914-179148936 GGCCGCCGCCCCGGCCGCGGTGG + Intronic
966911423 3:184562258-184562280 CGCCGCCGTCGCCGCCGCCGGGG + Exonic
968446828 4:656492-656514 GGCCGCGGTCACGGCCTTGCGGG - Intronic
968446840 4:656525-656547 GGCCGCGGTCACGGCCTCGCAGG - Intronic
968446851 4:656558-656580 GGCCGCGGTCACGGCCTCGCAGG - Intronic
968446861 4:656591-656613 GGCGGCGGTCACGGCCTCGCAGG - Intronic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968891681 4:3372597-3372619 GGCCGCCGCCACCTCCATGCCGG - Intronic
969431026 4:7154444-7154466 TGCTGCAGTCACCGCCTCGCTGG - Intergenic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970394714 4:15654888-15654910 GGCCGGCCCCACCGCCGCGCTGG - Intronic
972437051 4:39044792-39044814 GGCAGCCGACTGCGCCGCGCCGG + Intergenic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976595581 4:86892252-86892274 GGCCGCCGGCGCCGGCTCGCGGG - Intronic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
985696698 5:1344954-1344976 CGCCACCGCCACCGCCGCGGGGG + Exonic
988595300 5:32585521-32585543 AGACGCCGGCCCCGCCGCGCTGG - Exonic
988949337 5:36241672-36241694 CGCCACCGTCACCGCCCAGCCGG + Exonic
989229991 5:39074479-39074501 CGCCGCCGTCGCCGCCGAGGGGG - Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
994107323 5:95961738-95961760 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
995462440 5:112418794-112418816 GGCCGCTGTCCCCTGCGCGCAGG - Intronic
996871894 5:128201450-128201472 GGCATCCGCCACCGCCGGGCAGG + Intergenic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1001070286 5:168579508-168579530 GGCCGCCGGCCTCGCCGCTCCGG + Exonic
1002456016 5:179345649-179345671 CGCCGCCGTCGCCGCGGTGCCGG + Intergenic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003206947 6:4021387-4021409 AGCCGCCGCCACCGCCGCCGAGG + Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1010569966 6:77464129-77464151 CGCCGCCGCCACCGCCACCCTGG + Intergenic
1011610437 6:89145973-89145995 GGCCGCCCCCGGCGCCGCGCGGG - Intergenic
1016433066 6:144008141-144008163 GGTCGCCGTCATGGCCGCGGAGG - Intronic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019474993 7:1240224-1240246 GGCCGCCCTCACCGCGGCCTCGG - Intergenic
1020288802 7:6706711-6706733 CGCCGTCGTCACCGCCCGGCCGG + Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1022103806 7:27184599-27184621 AGCCGCCGCCGCCGCCGCGGAGG + Exonic
1022923394 7:35037620-35037642 CGCCGCCGTTGCCGCCGCTCCGG + Intronic
1024499820 7:50093151-50093173 CGCCGCCTGCCCCGCCGCGCTGG + Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1029281591 7:99439067-99439089 GGCCGCCGCCGCCGCCATGCAGG + Exonic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1034128920 7:148698595-148698617 GGCCGCCGGCAGCGGCGAGCGGG + Intronic
1034491617 7:151396016-151396038 GGCCGCGGCCTCCTCCGCGCAGG + Exonic
1034951295 7:155298359-155298381 GGCCGCCAGCCCCGCGGCGCTGG - Exonic
1035111124 7:156482893-156482915 GGCTGCCGTCAGCACCGCCCCGG + Intergenic
1035264922 7:157685236-157685258 GGCCGGGGTCGCCTCCGCGCTGG - Intronic
1035455426 7:159005936-159005958 GGCCGCAGGCACCGGAGCGCGGG - Intergenic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035601027 8:896732-896754 CACTGCCGTCACCTCCGCGCTGG + Intergenic
1036803269 8:11808604-11808626 GGGCGCAGGCACCGCCCCGCGGG + Intronic
1037865784 8:22441237-22441259 GGGCGCGGCCACCGCAGCGCCGG - Exonic
1038554178 8:28494747-28494769 GGCCCCTCTCTCCGCCGCGCAGG - Intronic
1040558880 8:48506178-48506200 GGCAGCCGTCAGGGCCGCGGAGG + Intergenic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044719849 8:95134294-95134316 GGACGCCGCCGCCGCCGCGGGGG + Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049177909 8:141205731-141205753 GGCGGCCGTGACGGCGGCGCAGG - Intergenic
1049625473 8:143617792-143617814 GCCAGCCGGCAGCGCCGCGCGGG + Intronic
1050343317 9:4662459-4662481 TGCCGCCGCCACCGCCGCCATGG - Exonic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1055308280 9:74952510-74952532 AGCCGCCGCCACCGCCTCTCTGG - Exonic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1057488563 9:95505899-95505921 GGCGGCCGCGGCCGCCGCGCTGG - Intronic
1058467564 9:105244659-105244681 AGCCGCCGTCGCCGCCGCCGGGG + Exonic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1059102396 9:111483513-111483535 GGCCGCCGCCTCCGCCTCCCAGG - Intronic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1060856121 9:126915518-126915540 GGCCGCCCTCTCCGCTGCCCAGG + Intronic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1061720184 9:132546594-132546616 GGCTGCCGAGACCCCCGCGCTGG + Intronic
1062646338 9:137550510-137550532 TGCCCCCATCCCCGCCGCGCTGG - Exonic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1186452926 X:9688135-9688157 AGCCGCCGCCGCCGCCGCACTGG - Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187464410 X:19515027-19515049 GGCCGCCGGCCGCGCCGCCCTGG + Exonic
1187826177 X:23334757-23334779 CGCCGCCGTCGCCGCCGCCGCGG + Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1196016355 X:110944462-110944484 GGCCGCCGCCACCACCGCTGCGG + Intronic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic